|
|
||||||||
Endocrinologia, Dipartimento di Medicina Interna e Medicina Specialistica, University of Catania, PO Garibaldi Nesima, Via Palermo 636, 95122 Catania, Italy1 Sezione di Endocrinologia, Dipartimento Clinico-Sperimentale di Medicina e Farmacologia, Azienda Ospedaliera Universitaria Policlinico, University of Messina, Via Consolare Valeria, 98122 Messina, Italy2 Unità Operativa di Anatomia Patologica, Ospedale Vittorio Emanuele, Via Plebiscito 628, 95124 Catania, Italy3 Divisione di Endocrinologia and 4 Servizio di Anatomia Patologica, Ospedale Cervello, Via Trabucco 180, 90146 Palermo, Italy5 Dana-Farber Cancer Institute, and Pathology Department, Medical Oncology and Center For Molecular Oncologic Pathology, Harvard Medical School, Brigham and Women's Hospital, 44 Binney Street, 02115 Boston, Massachusetts, USA6 Sezione di Endocrinologia, Dipartimento di Oncologia Sperimentale Clinica, Università degli Studi di Palermo, Policlinico, Via del Vespro 129, 90127 Palermo, Italy7 Dipartimento di Medicina Sperimentale e Farmacologia, Azienda Ospedaliera Universitaria Policlinico, University of Messina, Via Consulare Valeria, 98122 Messina, Italy8 Endocrinologia, Dipartimento di Medicina Sperimentale e Clinica, University of Catanzaro, Viale Europa, 88100 Germaneto Catanzaro, Italy
(Correspondence should be addressed to R Vigneri; Email: vigneri{at}unict.it)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Increased diagnostic activity and accuracy, with micro-papillary thyroid cancer (micro-PTCs; tumors up to 1 cm in diameter) increasing from 15–30 to 45–50% (Leenhardt et al. 2004), and changes in the histological WHO diagnostic criteria (Pathology and Genetics of Tumors of Endocrine Organs edited by R A DeLellis, R V Lloyd, P U Heitz and C Eng. IARC Press, Lyon 2004) have certainly contributed to the very high prevalence of the papillary histotype among thyroid cancer. However, a real increase of PTC incidence cannot be excluded and has been attributed to either iodine supplementation (Farahati et al. 2004) or exposure to radiation or other environmental endocrine disruptors, especially during childhood (Tronko et al. 2006).
Many genetic alterations have been implicated in PTCs, and mostly involve the aberrant activation of the RAS–RAF–MEK–MAP kinase pathway, due to either RET/PTC rearrangement (10–50% of PTCs; Nikiforov 2002, Santoro et al. 2002a), or RAS mutations (1–10% of PTCs; Giordano et al. 2005) or BRAF mutations (28–83% of PTCs; Xing 2005). BRAF is a serine–threonine kinase abundantly expressed in thyroid follicular cells (Daum et al. 1994), which activates MEK1 and MEK2 (Peyssonnaux & Eychene 2001). The most common BRAF mutation (BRAF(V600E)) accounts for over 90% of all BRAF mutations and consists of a thymine-to-adenine transversion at position 1799 in exon 15 of BRAF, leading to a valine-to-glutamate transversion at residue 600 and thus facilitating ATP binding (Garnett & Marais 2004). Analysis of BRAF exon 15 in large series of thyroid carcinomas indicated a high frequency of BRAF(V600E) in classical and tall cell variants of PTCs (Nikiforova et al. 2003, Nakamura et al. 2005, Xing et al. 2005). BRAF(V600E), but not RET/PTC rearrangements (Santoro et al. 1992), is often found in anaplastic thyroid cancer histotype (Begum et al. 2004), suggesting that this mutation may be involved in thyroid cancer progression to poorly differentiated and aggressive phenotypes (Nikiforova et al. 2003, Nikiforov 2004, Quiros et al. 2005). Studies evaluating RET/PTC rearrangement, BRAF(V600E), and RAS mutations indicated that in PTCs these molecular alterations are mutually exclusive and suggest that one activating mutation along the RAS–MAPK pathway is sufficient for thyroid cell malignant transformation (Melillo et al. 2005, Xing et al. 2005). However, different mechanisms and different tumor biology may characterize cancers arising from different oncogenes. At variance with RET/PTC, BRAF(V600E) positive PTCs were not found to be in relationship to previous radiation exposure (Nikiforova et al. 2004); no other environmental factors has been identified that favors BRAF(V600E) mutation.
Several studies tried to establish a correlation between BRAF(V600E) and the clinical features of PTCs, but results have been controversial (Lee et al. 2007, Xing 2007): in some studies, BRAF(V600E) was associated with a more advanced tumor or a more aggressive phenotype (Namba et al. 2003, Nikiforova et al. 2003, Kim et al. 2004, 2006a,b, Oler et al. 2005, Powell et al. 2005, Vasko et al. 2005, Xing et al. 2005, Jin et al. 2006, Lee et al. 2006, Riesco-Eizaguirre et al. 2006, Giannini et al. 2007, Kebebew et al. 2007, Lupi et al. 2007, Rodolico et al. 2007), while other studies did not find this association (Fugazzola et al. 2004, 2006, Puxeddu et al. 2004, Kim et al. 2005, Liu et al. 2005, Trovisco et al. 2005, Jo et al. 2006, Park et al. 2006, Sapio et al. 2006, Abrosimov et al. 2007, Durante et al. 2007, Mitsiades et al. 2007; see Table 1). Discrepancies between those studies, however, may depend on heterogeneous series of tumors, including different PTC variants and tumors from different geographical areas (Lee et al. 2007, Xing 2007).
|
30–50% of cases; Sedliarou et al. 2004, Barbaro et al. 2005, Trovisco et al. 2005). Micro-PTCs are thyroid tumors up to 10 mm in diameter, nearly always with papillary histotype and generally considered at a very low risk of progression and/or recurrence. Although predictors of persisting/relapsing disease have been established for PTCs over 10 mm in diameter and include lymph nodal metastases, extra-thyroid invasion, sclerosant variant, and bilateral foci, data on micro-PTCs are scanty (Lin et al. 2005, Ito et al. 2006). The possible predictive value of BRAF(V600E) in micro-PTCs is unknown. We have now examined the prevalence of BRAF(V600E) in a large series of PTCs, occurring in Sicilian residents, and report that BRAF(V600E) is a common genetic alteration in PTCs. BRAF(V600E) was significantly related to classical PTCs and also to greater tumor size, extra-thyroid invasion, lymph nodal metastases, and advanced stage. Moreover, BRAF(V600E) was independently associated with extra-thyroid invasion and with patient residency in certain geographical areas (Eastern Sicily), suggesting a possible link between environmental factors, BRAF mutation, and thyroid tumorigenesis.
| Patients and methods |
|---|
|
|
|---|
The study was designed as a BRAF(V600E) prevalence survey in PTC occurring in residents of the island of Sicily (a large island in the Mediterranean sea, 5.1 million inhabitants) and also an association study between BRAF(V600E) positivity in PTCs and tumor, host, and environmental variables. All patients were diagnosed and underwent surgery of the thyroid in the years 2002–2005. The study was approved by our institution's Ethics and Research Committees and was in agreement with the World Medical Association's 1975 Declaration of Helsinki, revised in 1983. Paraffin-embedded specimens were obtained from Pathological Anatomy Institutes from all geographical areas of Sicily. Histological slides, after hematoxylin and eosin staining, were reviewed by two independent pathologists to confirm the diagnosis and to classify the papillary tumors for the different PTC histotype variants, based on the histopathological typing of the World Health Organization Classification of Tumors (Pathology and Genetics of Tumors of Endocrine Organs; R A DeLellis, R V Lloyd, P U Heitz and C Eng. Eds; IARC Press, Lyon, 2004). Classical papillary thyroid carcinomas were classified all carcinomas containing true papillae with a central fibrovascular core and a lining of cuboidal cells with ground glass nuclei, nuclear pseudoinclusions, and nuclear grooves. We considered as follicular variant papillary thyroid carcinomas (FV-PTCs) tumors composed entirely or almost entirely of follicles, with cells displaying nuclear features of PTCs. Tall cell variant papillary carcinomas (TCV-PTCs) were characterized by papillae lined by a single layer of tall cells (height at least twice the width), with nuclei usually lacking the features of classical papillary thyroid carcinomas and present in more than 50% of each slide. Finally, PTCs measuring 10 mm or less in maximum diameter were considered micro-PTCs.
As a total, 393 archival specimens were collected: 323 were PTCs and are the object of the present study. Additional 70 specimens that included normal (peritumoral or controlateral) thyroid tissue and colloid goiters, follicular adenomas and carcinomas, and anaplastic carcinomas (ATCs) were also examined at the same time.
Surgery medical records provided the information regarding patients (age, sex, and residence) and tumors (volume, multifocality, bilaterality, lymph nodal involvement, extra-thyroid invasion, distant metastases, and grading). Clinical staging of thyroid cancer was classified according to the Tumor-node-metastasis (TNM) classification (VI Edition; Dobert et al. 2004). Persistent disease was evaluated in 118 patients, with a 2- to 4-year follow-up.
Information regarding environmental goitrogens (iodine deficiency and cyanate) were obtained by previous scientific publications regarding the presence of these goitrogens in different areas of Sicily (Delange et al. 1978, Belfiore et al. 1987, 1992, Vigneri 1988).
Laser capture microdissection (LCM), DNA isolation, and sequencing
Ten micrometer sections of paraffin-embedded thyroid tissue samples (micro-PTCs and TCV-PTCs) were deparaffinized with xylene, washed with ethanol, rehydrated in deionized water, and stained with hematoxylin and eosin. Normal thyroid follicular cells and a subset of micro-PTCs and TCV-PTCs with prominent stromal component were microdissected by Prof. M Loda at the Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA, using the Veritas LCM and Laser Cutting System (model LCC1704) from Arcturus Engineering (Mountain View, CA, USA). The presence of the tumor tissue was confirmed in the first and the last section for each section series. Microdissected tissues were collected on CapSure Macro LCM Caps (Arcturus Bioscience, Basel, Switzerland). Genomic DNA was extracted using Pico Pure DNA extraction kit (Arcturus Bioscience), according to the manufacturer's recommendations. The samples were immediately placed into 50 µl proteinase K DNA extraction solution and incubated at 65 °C for 16 h. Samples were subsequently heated at 95 °C for 10 min to inactivate the proteinase K, centrifuged, and the supernatant collected. DNA was measured with NanoDrop ND-1000 spectrophotometer (Wilmington, DE, USA) and used as template for PCR amplification and sequencing analysis. The following intron-based PCR primers were designed to amplify the BRAF exon 15: forward TCATAATGCTTGCTCTGATAGGA and reverse GGCCAAAAATTTAATCAGTGGA. PCRs were performed using standard PCR conditions (95 °C for 5 min, 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, for 40 cycles; 70 °C for 10 min). p53 mutations were evaluated by PCR using primers amplifying p53 exons 5–8, in accordance with Fagin et al. (1993). H-, N-, and K-Ras families (codons 12/13 and 59/61) were evaluated by PCR using primers in accordance with Vasko et al. (2003). The amplified products were purified by MinElute PCR Purification kit (Qiagen) and sequenced on an ABI PRISM 3730xl automated capillary DNA Sequencer using the BigDye 3.1 terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Foster City CA, USA).
RT-PCR
Frozen thyroid tissues were available in 50 cases of papillary thyroid carcinomas and 10 normal thyroid tissues near tumor. Total RNA was extracted from 30 to 100 mg tissue using a commercial kit (Trizol, Invitrogen-Life Technologies), according to the manufacturer's protocol.
Total RNA was reverse transcribed into cDNA using ThermoScript RT-PCR system (Invitrogen-Life Technologies). In particular, 1 µg RNA recovered from fresh tissues was used for the production of cDNA in a mixture containing 10 mM dNTP mix, 1 µl random hexameres (50 ng/µl), 5x cDNA synthesis buffer (250 mM Tris acetate pH 8.4, 375 mM potassium acetate, and 40 nM magnesium acetate), 0.1 M dithiothreitol, 15 U ThermoScript transcriptase, and 40 U RNaseOUT (Invitrogen-Life Technologies) in a final volume of 20 µl using the following RT-PCR conditions: denature RNA by incubating at 65 °C for 5 min and then the samples were incubated at 25 °C for 10 min, followed by 50 min at 55 °C. To verify the integrity of mRNA of all samples, primers specific for the ELE-1 gene (forward ATTGAAGAAATTGCAGGCTC and reverse TGGAGAAGAGGAGCTGTATCT) were used as a control. Moreover, cDNA was also used for the detection of AKAP9–BRAF rearrangement by PCR analysis and using primers located in exon 8 of AKAP9 (Ex8A, 5'-AGCAAGAACAGTTGATTTTGGA-3') and exon 10 of BRAF (Ex10B, 5'-GCAGACAAACCTGTGGTTGA-3', with the expected product of 181 bp, according to Ciampi et al. (2005).
The activation of tyrosine kinase (TK) domain of the RET was screened according to Santoro et al. (2002b) (sense primer 5'-TGGGAATTCCCTCGGAAGAA-3', nucleotide position 2149–2168; antisense primer 5'-TGCAGGCCCCATACAATTTG-3', nucleotide position 2364–2383; expected fragment size 235 bp). RET/PTC1 and RET/PTC3 rearrangement expression were performed through PCR analysis using reaction conditions according to Puxeddu et al. (2003). RET/PTC-1 was amplified using sense primer 5'-GCTGGAGACCTACAAACTGA-3' and antisense primer 5'-GTTGCCTTGACCACTTTTC-3' (expected fragment size 165 bp); RET/PTC-3 was amplified using sense primer 5'-AAGCAAACCTGCCAGTGG-3' and antisense primer 5'-CTTTCAGCATCTTCACGG-3' (expected fragment size 242 bp). Positive controls included cDNA samples from a thyroid medullary carcinoma with constitutive expression of wild-type RET (for amplification of RET-TK), cDNA samples of TPC-1 cell line for amplification of RET/PTC1, and cDNA samples of a classical papillary carcinoma (PTC) case (kindly provided by Dr E Puxedddu, University of Perugia) for amplification of RET/PTC3. Amplification in the absence of RNA was used as a negative control. Experiments to investigate RET-TK activation, RET/PTC1 and RET/PTC3 rearrangement expression were carried out for five times. Finally, the specificity of rearrangements was verified by direct sequencing analysis.
Immunohistochemistry (IHC)
Thyroid tissue sections were immunohistochemically stained for matrix metalloproteinase-2 and -9 (MMP-2 and MMP-9), using the standard avidin–biotin peroxidase complex (ABC) method. In brief, the sections were processed to unmask antigens by means of microwave oven heating in 10 nM citric acid buffer (pH 6.0) and subsequent detergent treatment using polyoxyethylene sorbitan monolaurate (Tween 20) for 30 min. The sections were then treated with normal serum for 20 min, followed by the application (4 °C overnight) of primary monoclonal antibodies against either MMP-2 (clone A-Gel-VC2, dilution 1:1000) or MMP-9 (polyclonal, dilution 1:500; Thermo Scientific, Freemont, CA, USA). The sections were then treated with a biotinylated antibody (Vector Lab, Burlingame, CA, USA), and then with the ABC (Vectastein ABC kit, Vector Lab) for 1 h each. The reaction products were developed in 3.3-diaminobenzidine tetrahydrochloride solution containing 0.03% H2O2. Nuclei were lightly counterstained with hematoxylin. No staining was obtained when nonimmune serum or PBS was used instead of the primary antibodies. Finally, we have used the following staining intensity in order to evaluate MMP-2 and MMP-9 immunohistochemical expression: 3+ (strong), 2+ (moderate), 1+ (weak), and 0 (absent). The average score in our series was 2 to 3+. The threshold of positivity for MMP staining was 1+ in more than 50% of each tumor slide.
Statistical analysis
Group comparisons of categorical variables were performed using the Fisher's exact test for independence. Nonparametric statistics was used to compare the continuous variables. Multivariate logistic regression analyses were used to assess the independent association of BRAF(V600E) mutation with the different host and geographical characteristics. A P value <0.05 was considered statistically significant. Statistical analysis was performed with the StatView Software (SAS Institute, Cary, NC, USA).
| Results |
|---|
|
|
|---|
BRAF(V600E) mutation was evaluated in a series of 323 papillary carcinomas (PTCs) by direct DNA sequencing of the PCR-amplified exon 15. Overall, the prevalence of BRAF(V600E) in PTCs was 125 out of 323 (38.6%). When the prevalence of BRAF(V600E) was calculated for each PTC histological variant it was present in 116 out of 223 (52%) C-PTCs, 9 out of 34 (26.4%) TCV-PTCs, none of the 52 FV-PTCs, and none of the remaining 14 PTCs, including Warthin-like, diffuse sclerosant, and oncocytic variant PTCs. Additional 70 specimens including 16 goiters, 15 specimens of peritumoral normal thyroid tissue, 12 follicular adenomas, and 12 follicular carcinomas were all BRAF(V600E) negative. In contrast, BRAF(V600E) was found in 5 out of 15 (33.3%) ATCs.
An aliquot of the 323 PTC specimens was also examined by sequencing for other thyroid cancer common molecular abnormalities, including mutations of BRAF exon 11 (n=207 PTCs), K-, N-, and H-Ras (61 PTCs including 24 classical PTCs, 24 FV-PTCs, and 13 TCV-PTCs, all negative for BRAF(V600E)), and of p53 (n=14 ATCs). With the exception of one mutation in codon 273 of TPp53 in one ATC, no other mutation was found. RET/PTC and AKAP9–BRAF rearrangements were also evaluated in 50 PTCs, where frozen tissue was available. All samples were negative for AKAP9–BRAF rearrangement; one tumor was positive for RET/PTC-1 and another for RET/PTC-3 rearrangements (2 out of 50 cases=4%). Both these tumors were negative for BRAF(V600E).
These data are in accordance with previous reports (Nikiforova et al. 2003, Trovisco et al. 2004, Nakamura et al. 2005, Xing et al. 2005) and indicate that BRAF(V600E) is the most common molecular abnormality in PTCs. BRAF(V600E) mutation is strongly associated with the classical PTC histotype (C-PTC) and is also present in approximately one out of four TCV-PTCs and one out of three ATCs.
BRAF(V600E) and PTC patient characteristics
We first evaluated the correlation between the presence of BRAF(V600E) mutation and patient characteristics, including age, sex, and geographical residency of the patient in Sicily, by univariate analysis (Table 2). The presence of BRAF(V600E) was not associated with patient age or gender (P=0.7709 and 0.6887 respectively) in accordance with some (Puxeddu et al. 2004, Sedliarou et al. 2004) but not all previous reports (Penko et al. 2005, Powell et al. 2005, Rosenbaum et al. 2005).
|
|
Correlation between BRAF(V600E) mutation and clinicopathological features of PTCs
A positive correlation between BRAF(V600E) and PTC aggressiveness has been reported in some studies but not in all studies (Table 1). These differences might be due to the heterogeneity of PTCs recruited, in terms of different histological subtypes, different populations studied (in many series patients were from different areas or even different Countries). Genetic and/or environmental differences, therefore, might have influenced the results obtained.
In our homogeneous series, we first analyzed the association between BRAF(V600E) positivity and histopathological parameters of tumor aggressiveness (Table 3). By univariate analysis, the presence of BRAF(V600E) in the 323 PTCs was strongly associated with greater tumor size (P=0.0048), extra-thyroid invasion (P<0.0001), and lymph nodal metastases (P=0.0001; Table 3, Top). A weak association was observed with stages III–IV (P=0.051; Table 3, Top). Moreover, in a subset of 118 PTCs, where follow-up longer than 2 years was already available, a weak association of BRAF(V600E) and persistent disease was also found (P=0.0531; Table 3, Top). No significant correlation was found with multiple foci (P=0.1717). Distant metastases and tumor recurrence were not evaluated because of the insufficient number for statistical analysis. Univariate analysis, therefore, suggested that BRAF(V600E) mutation in PTCs was strongly associated with at least three markers of aggressive and invasive disease.
|
Since the presence of BRAF(V600E) is more frequent in PTCs of larger size (over 10 mm), a parameter that may strongly influence tumor aggressiveness and staging, we then performed a multivariate logistic regression analysis by first adjusting for tumor size (Table 3, bottom). With this analysis, a significant correlation was still found between BRAF(V600E) presence and both extra-thyroid invasion (P=0.0001) and lymph nodal metastasis (P=0.0005) but not with more advanced tumor stage (a likely consequence of the fact that size is an important parameter for tumor staging). These results indicate that BRAF(V600E) is a good predictor of extra-thyroid invasion and lymph nodal metastases, independently from tumor size.
We then evaluated whether patient geographical residence could affect the relationship between BRAF(V600E)positivity and tumor aggressiveness (Table 3, bottom). The correlation between BRAF(V600E) positivity and extra-thyroid invasion was significant both in patients living in Eastern Sicily and Western Sicily at univariate analysis (not shown). At multivariate analysis, after adjusting for patient provenience, BRAF(V600E) correlation with extra-thyroid invasion and lymph nodal metastases was also significant (P=0.0002 and 0.0004 respectively; Table 3 bottom).
Data were then adjusted for patient age, gender, and residence and also for tumor characteristics such as multifocality, size, and histology subtype. The association of BRAF(V600E) with extra-thyroid invasion, lymph nodal metastasis, and advanced stage was maintained (P<0.0001, P=0.0074, and P=0.0374 respectively; Table 3, bottom), confirming that BRAF(V600E) is a good independent predictor of tumor aggressiveness. A possible relationship between these three parameters, independent from BRAF(V600E) cannot be excluded, especially for advanced stage, which is influenced by both extra-thyroid invasion and lymph nodal metastases. To test this hypothesis, extra-thyroid invasion was adjusted for lymph nodal metastases and vice versa (Table 3, bottom). At this additional analysis, the association of BRAF(V600E)with extra-thyroid invasion was maintained (P=0.003), while the correlations with lymph nodal metastases (P=0.089) and advanced stage were lost (Table 3, bottom). These analyses support the possibility that the association between BRAF(V600E) and extra-thyroid invasion, but not lymph nodal metastases is an independent relationship. In contrast, the association between BRAF(V600E) and advanced stage is most likely influenced by the other two parameters (Table 3, bottom).
Taken together these results suggest that BRAF(V600E) is independently and strongly associated with extra-thyroid invasion and also with other indicators of tumor aggressiveness.
Association of BRAF(V600E) with the expression of MMPs
Recent reports indicated that of BRAF(V600E) is able to induce MMPs, which play an important role in tumor invasiveness and metastasis (Maeta et al. 2001, Mesa et al. 2006). We tested therefore the hypothesis that BRAF(V600E) may promote tumor invasiveness by up-regulating MMPs. Sixty classical PTCs were studied by IHC, staining with either anti-MMP-2 or MMP-9 antibodies. MMP-2 was detected in 32 specimens (53.3%), whereas MMP-9 in 52 out of 60 (86.7%; Table 4). At univariate analysis, a significant correlation was found between BRAF(V600E) positivity and IHC detection of either MMP-2 or MMP-9 or both (P=0.028). At the same time, the presence of both MMP-2 and MMP-9 was significantly correlated (P=0.030) with tumor extra-thyroid extension. These results confirm that MMP expression is related to the presence of BRAF(V600E) and to tumor invasiveness in man. They suggest, therefore, that MMPs are possible mediators of BRAF(V600E) effect on tumor invasiveness.
|
Since there is a strong correlation between BRAF(V600E) presence and tumor size, we separately examined tumors having a maximum diameter of 10 mm or less (micro-PTCs, n=103/323). In these small tumors, tissue sampling for BRAF(V600E) analysis was performed using microdissection (see Patients and methods).
We investigated whether BRAF(V600E) positivity was associated with increased tumor invasiveness also in micro-PTCs. First, BRAF(V600E) was present in 25 out of 103 micro-PTCs (24.3%, Table 4), significantly less than in PTCs (100 BRAF(V600E) positive out of 220=45.5%; P=0.0017; Table 5). These findings are compatible with the possibility that most tumors that are BRAF(V600E) positive progress to a larger size while, in contrast, most tumors that are BRAF(V600E) negative are stationary or progress slowly in volume. Second, at univariate analysis, a strong positive association (P=0.006) was found between BRAF(V600E) and extra-thyroid invasion also in micro-PTCs. Third, in BRAF(V600E) positive micro-PTCs, a significantly higher prevalence of stages III and IV tumor was observed (Fig. 2). When we compared micro-PTCs with PTCs, the percentage of tumors in stage III or IV was higher in PTCs, both in the BRAF(V600E) positive and in the BRAF(V600E) negative tumors. The differences between PTCs and micro-PTCs, however, were markedly smaller and nonsignificant in the BRAF(V600E) positive tumors while were highly significant in BRAF(V600E) negative tumors (Fig. 2). This observation is in concert with the multivariate analysis data indicating that the relationship between BRAF(V600E) positivity and tumor aggressiveness holds after adjusting for tumor size and is compatible with the possibility that BRAF(V600E) presence confers an increased aggressiveness to PTCs, whatever their size. BRAF(V600E) positivity, therefore, could be used as a molecular marker useful in order to identify micro-PTCs that require a more intensive treatment and follow-up.
|
|
| Discussion |
|---|
|
|
|---|
It differs, therefore, from BRAF(V600E) investigations in other thyroid cancer series where patients were recruited at different times and/or from different populations with the possibility that a different genetic background and/or environmental characteristics, in addition to a significant heterogeneity in the medical procedures may have influenced the clinical results of the study.
In our series, BRAF(V600E) was positive in 52% classical variant PTCs and 26.4% tall cell PTCs, frequent also in anaplastic cancers (33.3%), while it was always absent in follicular variant PTCs and in follicular tumors, both benign (adenomas) and malignant. Abnormalities of RET/PTC, Ras were very rare in our series as well as BRAF mutations others than BRAF(V600E). It is confirmed, therefore, that BRAF(V600E) is the most common defined genetic abnormality in PTCs (overall 38.6% in our series) and that constitutive activation of the RAS–RAF–MEK pathway is specific for the papillary architecture of thyroid cancers. At variance with most studies (Nikiforova et al. 2003, Nakamura et al. 2005, Xing 2005, Xing et al. 2005), however, BRAF(V600E) was not frequent in our series of tall cell PTCs. This finding is in accordance with some previous reports (Trovisco et al. 2004, 2005, Fugazzola et al. 2006) and may depend on the absence of squamous cell and Hurthle cell carcinoma components, as previously observed (Baloch et al. 2001, Knudsen et al. 2002, Zwi & LiVolsi 2002). Moreover, some discrepancy may exist in PTC subgroup definitions by different pathologists. In our series, tall cell variant PTCs were identified by the presence of at least 50% tall cell component in each tumor sample.
Our study clearly indicates that the presence of BRAF(V600E) mutation in PTCs is associated with an aggressive tumor behavior. Both univariate and multivariate analyses indicated that BRAF(V600E) was a good predictor of extra-thyroid invasion and lymph nodal metastases, even after adjusting for tumor size, multifocality, histology subtype and also for patient characteristics such as age and gender.
The association between BRAF(V600E) mutation and clinicopathological factors of tumor aggressiveness has already been addressed in many studies and the conclusions have been controversial (Lee et al. 2007, Xing 2007). This relationship, in fact, has been observed in some studies but not in other studies (Table 1). However, study size (see Table 1), different recruitment, and follow-up procedures and also factors such as tumor classification may have made data in many of those studies less consistent and reliable (Lee et al. 2007, Xing 2007).
We believe that the present data add convincing evidence that BRAF(V600E) is an important marker of tumor invasiveness and, moreover, that this relationship is independent from tumor size. Although BRAF(V600E) mutation was found more frequent in PTCs (45.5%) with respect to micro-PTCs (<10 mm in diameter, 24.3%, P<0.0017), also in micro-PTCs BRAF(V600E) positivity was significantly related to extra-thyroid invasion and more advanced stage suggesting that, although small, BRAF(V600E) positive tumors carry a higher risk of progression and invasiveness than tumors of the same size but BRAF(V600E) negative. In fact, micro-PTCs, although having an excellent prognosis in most cases, may include a consistent aliquot that will progress to more advanced stage and less favorable outcome in terms of disease persistence and/or recurrence (Pelizzo et al. 2004, Pellegriti et al. 2004, Barbaro et al. 2005, Ito et al. 2005, Lo et al. 2006).
BRAF(V600E) positive micro-PTCs, therefore, may faster progress to larger size, whereas BRAF(V600E) negative micro-PTCs may predominantly have a slower and more indolent growth. This would explain the different prevalence of BRAF(V600E) positivity in larger versus smaller PTCs.
Although the predictive power of BRAF(V600E) for identifying micro-PTCs at higher risk of progression will require prospective studies with systematic BRAF measurement and long-term follow-up, it may be important to consider the possibility that BRAF(V600E) positivity might provide an invasiveness marker and permit a better risk stratification in small thyroid tumors that are nearly always classified T1 N0 M0 at the TNM classification, with no appreciable difference for those micro-PTCs that, although small, may have a less favorable outcome.
The present study provides also some evidences regarding the possible mechanism linking BRAF(V600E) positivity to tumor invasiveness. Recent data indicated that MMP (secreted proteinases that cause extracellular matrix degradation favoring tumor invasion) are preferentially induced by BRAF (Mesa et al. 2006, Palona et al. 2006). MMP expression is associated with markedly increased invasion of the extracellular matrix in cultured thyroid cells and with lymph nodal metastases, intra-thyroid, and vascular invasion in human PTCs (Maeta et al. 2001). In concert with this hypothesis in our nested study of 60 CV-PTCs, MMPs were expressed more frequently in BRAF(V600E) positive than BRAF(V600E) negative tumors. At the same time, PTCs expressing both MMP-2 and MMP-9 had significantly more frequent signs of extra-thyroid extension (P=0.030) with respect to those MMP-negative thyroid tumors. Although the complexity of the MMP system (which includes activators and inhibitors in addition to enzyme expression) was not investigated in our study, the association between BRAF(V600E), MMP expression, and tumor invasiveness is in concert with the possibility that this is one mechanism through which BRAF(V600E) promotes cancer spread and invasiveness.
An additional point that deserves attention is the important difference of BRAF(V600E) positivity in PTCs occurring in patients from different geographical areas of the same region. BRAF(V600E) positive PTCs were 45.9% in Eastern Sicily versus 22.7% in Western Sicily (P=0.0001). Populations from either Eastern or Western Sicily must be considered ethnically and genetically homogeneous because of the frequent exchanges and communications between the two areas in addition they display a similar risk for overall malignancies. The most likely explanation is that one or more environmental carcinogens, active in Eastern Sicily, contribute to the higher prevalence of BRAF(V600E) positive thyroid tumors in that area. Iodine deficiency is not the cause of this difference. Although
1 out of 10 of the Sicilian population is exposed to mild-moderate iodine deficiency and related diseases (Belfiore et al. 1987, 1992, Vigneri 1988, Regalbuto et al. 1996), the frequency of BRAF(V600E) positive PTCs was not different in tumors occurring in patients from iodine-deficient areas (which are scattered all over Sicily) or iodine-sufficient areas.
A recent survey on thyroid tumors in Sicily, collecting data on tumor incidence for 3 consecutive years, indicated that thyroid cancer incidence is much higher in North-Eastern Sicily (unpublished data). This area includes the volcano Etna, the highest and most active volcano in Europe. Data from the literature indicate a high frequency of thyroid tumors also in other volcanic areas (such as Hawaii, Iceland, Philipines; Kolonel 1985, Arnbjornsson et al. 1986, Hernandez 2003). It is reasonable, therefore, to hypothesize that some thyroid carcinogens, not identified up to now, might be present in the volcanic soil, water, or atmosphere (Cimino & Toscano 1998). This hypothesis is supported by the observation of an increased incidence of other tumors (mesothelioma) in the same volcanic area (town of Biancavilla) due to an increased exposure to asbestos amphibole fluoro-edenite contained in quarry extracted materials (Comba et al. 2003). The novel information from the present study is that BRAF(V600E) mutation may be a specific genetic abnormality induced also by environmental carcinogens. This hypothesis requires, of course, confirmation. If confirmed by in vivo and in vitro studies, it may provide relevant information both in terms of preventive medicine and also for a better understanding of the biology of PTC.
| Acknowledgements |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Akslen LA, Haldorsen T, Thoresen SO & Glattre E 1993 Incidence pattern of thyroid cancer in Norway: influence of birth cohort and time period. International Journal of Cancer 53 183–187.[CrossRef][Medline]
Arnbjornsson E, Arnbjornsson A & Olafsson A 1986 Thyroid cancer incidence in relation to volcanic activity. Archives of Environmental Health 41 36–40.[Medline]
Baloch ZW, Mandel S & LiVolsi VA 2001 Combined tall cell carcinoma and Hurthle cell carcinoma (collision tumor) of the thyroid. Archives of Pathology & Laboratory Medicine 125 541–543.[Web of Science][Medline]
Barbaro D, Simi U, Meucci G, Lapi P, Orsini P & Pasquini C 2005 Thyroid papillary cancers: microcarcinoma and carcinoma, incidental cancers and non-incidental cancers – are they different diseases? Clinical Endocrinology 63 577–581.[CrossRef][Medline]
Begum S, Rosenbaum E, Henrique R, Cohen Y, Sidransky D & Westra WH 2004 BRAF mutations in anaplastic thyroid carcinoma: implications for tumor origin, diagnosis and treatment. Modern Pathology 17 1359–1363.[CrossRef][Web of Science][Medline]
Belfiore A, La Rosa GL, Padova G, Sava L, Ippolito O & Vigneri R 1987 Prevalence of cold thyroid nodules and thyroid malignancies in patients from an iodine deficient area. Cancer 60 3096–3102.[CrossRef][Web of Science][Medline]
Belfiore A, La Rosa GL, La Porta GA, Giuffrida D, Milazzo G, Lupo L, Regalbuto C & Vigneri R 1992 Cancer risk in patients with cold thyroid nodules. Relevance of iodine intake, sex, age and multinodularity. American Journal of Medicine 93 363–369.[CrossRef][Web of Science][Medline]
Ciampi R, Knauf JA, Kerler R, Gandhi M, Zhu Z, Nikiforova MN, Rabes HM, Fagin JA & Nikiforov YE 2005 Oncogenic AKAP9-BRAF fusion is a novel mechanism of MAPK pathway activation in thyroid cancer. Journal of Clinical Investigation 115 94–101.[CrossRef][Web of Science][Medline]
Cimino G & Toscano G 1998 Dissolution of trace metals from lava ash: influence on the composition of rainwater in the Mount Etna volcanic area. Environmental Pollution 99 389–393.[CrossRef][Medline]
Colonna M, Grosclaude P, Remontet L, Schvartz C, Mace-Lesech J, Velten M, Guizard A, Tretarre B, Buemi AV, Arveux P et al. 2002 Incidence of thyroid cancer in adults recorded by French cancer registries. European Journal of Cancer 38 1762–1768.[CrossRef][Web of Science][Medline]
Comba P, Gianfagna A & Paoletti L 2003 Pleural mesothelioma cases in Biancavilla are related to a new fluoro-edenite fibrous amphibole. Archives of Environmental Health 58 229–232.[Web of Science][Medline]
Daum G, Eisenmann-Tappe I, Fries HW, Troppmair J & Rapp UR 1994 The ins and outs of Raf kinases. Trends in Biochemical Sciences 19 474–480.[CrossRef][Web of Science][Medline]
Delange F, Vigneri R, Trimarchi F, Filetti S, Pezzino V, Squatrito S, Bourdoux P & Ermans AM 1978 Etiological factors of endemic goiter in north-eastern Sicily. Journal of Endocrinological Investigation 1 137–142.[Medline]
Dobert N, Menzel C, Oeschger S & Grunwald F 2004 Differentiated thyroid carcinoma: the new UICC. 6th ed. TNM classification system in a retrospective analysis of 169 patients. Thyroid 14 65–70.[CrossRef][Web of Science][Medline]
Durante C, Puxeddu E, Ferretti E, Morisi R, Moretti S, Bruno R, Barbi F, Avenia N, Scipioni A, Verrienti A et al. 2007 BRAF mutations in papillary thyroid carcinomas inhibit genes involved in iodine metabolism. Journal of Clinical Endocrinology and Metabolism 92 2840–2843.
Fagin JA, Matsuo K, Karmakar A, Chen DL, Tang SH & Koeffler HP 1993 High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. Journal of Clinical Investigation 91 179–184.[Web of Science][Medline]
Farahati J, Geling M, Mader U, Mortl M, Luster M, Muller JG, Flentje M & Reiners C 2004 Changing trends of incidence and prognosis of thyroid carcinoma in lower Franconia, Germany, from 1981–1995. Thyroid 14 141–147.[CrossRef][Medline]
Fugazzola L, Mannavola D, Cirello V, Vannucchi G, Muzza M, Vicentini L & Beck-Peccoz P 2004 BRAF mutations in an Italian cohort of thyroid cancers. Clinical Endocrinology 61 239–243.[CrossRef][Medline]
Fugazzola L, Puxeddu E, Avenia N, Romei C, Cirello V, Cavaliere A, Faviana P, Mannavola D, Moretti S, Rossi S et al. 2006 Correlation between BRAFV600E mutation and clinico-pathologic parameters in papillary thyroid carcinoma: data from a multicentric Italian study and review of the literature. Endocrine-Related Cancer 13 455–464.
Garnett MJ & Marais R 2004 Guilty as charged: BRAF is a human oncogene. Cancer Cell 6 313–319.[CrossRef][Web of Science][Medline]
Giannini R, Ugolini C, Lupi C, Proietti A, Elisei R, Salvatore G, Berti P, Materazzi G, Miccoli P, Santoro M et al. 2007 The heterogeneous distribution of BRAF mutation supports the independent clonal origin of distinct tumor foci in multifocal papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism 92 3511–3516.
Giordano TJ, Kuick R, Thomas DG, Misek DE, Vinco M, Sanders D, Zhu Z, Ciampi R, Roh M, Shedden K et al. 2005 Molecular classification of papillary thyroid carcinoma: distinct BRAF, RAS, and RET/PTC mutation-specific gene expression profiles discovered by DNA microarray analysis. Oncogene 24 6646–6656.[CrossRef][Web of Science][Medline]
Gomez Segovia I, Gallowitsch HJ, Kresnik E, Kumnig G, Igerc I, Matschnig S, Stronegger WJ & Lind P 2004 Descriptive epidemiology of thyroid carcinoma in Carinthia, Austria: 1984–2001. Histopathologic features and tumor classification of 734 cases under elevated general iodination of table salt since 1990: population-based age-stratified analysis on thyroid carcinoma incidence. Thyroid 14 277–286.[CrossRef][Medline]
Hernandez BY 2003 Highlights of recent cancer incidence data in Hawaii. Hawaii Medical Journal 62 17–18.[Medline]
Howe HL, Wingo PA, Thun MJ, Ries LA, Rosenberg HM, Feigal EG & Edwards BK 2001 Annual report to the nation on the status of cancer (1973 through 1998), featuring cancers with recent increasing trends. Journal of the National Cancer Institute 93 824–842.
Ito Y, Uruno T, Takamura Y, Miya A, Kobayashi K, Matsuzuka F, Kuma K & Miyauchi A 2005 Papillary microcarcinomas of the thyroid with preoperatively detectable lymph node metastasis show significantly higher aggressive characteristics on immunohisto chemical examination. Oncology 68 87–96.[CrossRef][Medline]
Ito Y, Tomoda C, Uruno T, Takamura Y, Miya A, Kobayashi K, Matsuzuka F, Kuma K & Miyauchi A 2006 Prognostic significance of extrathyroid extension of papillary thyroid carcinoma: massive but not minimal extension affects the relapse-free survival. World Journal of Surgery 30 780–786.[CrossRef][Medline]
Jin L, Sebo TJ, Nakamura N, Qian X, Oliveira A, Majerus JA, Johnson MR & Lloyd RV 2006 BRAF mutation analysis in fine needle aspiration (FNA) cytology of the thyroid. Diagnostic Molecular Pathology 15 136–143.[CrossRef][Medline]
Jo YS, Li S, Song JH, Kwon KH, Lee JC, Rha SY, Lee HJ, Sul JY, Kweon GR, Ro HK et al. 2006 Influence of the BRAF V600E mutation on expression of vascular endothelial growth factor in papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 91 3667–3670.
Kebebew E, Weng J, Bauer J, Ranvier G, Clark OH, Duh QY, Shibru D, Bastian B & Griffin A 2007 The prevalence and prognostic value of BRAF mutation in thyroid cancer. Annals of Surgery 246 466–471.[CrossRef][Medline]
Kim KH, Kang DW, Kim SH, Seong IO & Kang DY 2004 Mutations of the BRAF gene in papillary thyroid carcinoma in a Korean population. Yonsei Medical Journal 45 818–821.[Web of Science][Medline]
Kim TY, Kim WB, Song JY, Rhee YS, Gong G, Cho YM, Kim SY, Kim SC, Hong SJ & Shong YK 2005 The BRAF mutation is not associated with poor prognostic factors in Korean patients with conventional papillary thyroid microcarcinoma. Clinical Endocrinology 63 588–593.[CrossRef][Medline]
Kim J, Giuliano AE, Turner RR, Gaffney RE, Umetani N, Kitago M, Elashoff D & Hoon DS 2006a Lymphatic mapping establishes the role of BRAF gene mutation in papillary thyroid carcinoma. Annals of Surgery 244 799–804.[CrossRef][Medline]
Kim TY, Kim WB, Rhee YS, Song JY, Kim JM, Gong G, Lee S, Kim SY, Kim SC, Hong SJ et al. 2006b The BRAF mutation is useful for prediction of clinical recurrence in low-risk patients with conventional papillary thyroid carcinoma. Clinical Endocrinology 65 364–368.[CrossRef][Medline]
Knudsen N, Laurberg P, Perrild H, Bulow I, Ovesen L & Jorgensen T 2002 Risk factors for goiter and thyroid nodules. Thyroid 12 879–888.[CrossRef][Web of Science][Medline]
Kolonel LN 1985 Cancer incidence among Filipinos in Hawaii and the Philippines. National Cancer Institute Monographs 69 93–98.[Medline]
Lee JH, Lee ES, Kim YS, Won NH & Chae YS 2006 BRAF mutation and AKAP9 expression in sporadic papillary thyroid carcinomas. Pathology 38 201–204.[CrossRef][Web of Science][Medline]
Lee JH, Lee ES & Kim YS 2007 Clinicopathologic significance of BRAF V600E mutation in papillary carcinomas of the thyroid: a meta-analysis. Cancer 110 38–46.[CrossRef][Medline]
Leenhardt L, Grosclaude P & Cherie-Challine L 2004 Increased incidence of thyroid carcinoma in France: a true epidemic or thyroid nodule management effects? Report from the French Thyroid Cancer Committee. Thyroid 14 1056–1060.[CrossRef][Web of Science][Medline]
Lin JD, Chen ST, Chao TC, Hsueh C & Weng HF 2005 Diagnosis and therapeutic strategy for papillary thyroid micro carcinoma. Archives of Surgery 140 940–945.
Liu RT, Chen YJ, Chou FF, Li CL, Wu WL, Tsai PC, Huang CC & Cheng JT 2005 No correlation between BRAFV600E mutation and clinicopathological features of papillary thyroid carcinomas in Taiwan. Clinical Endocrinology 63 461–466.[CrossRef][Medline]
Lo CY, Chan WF, Lang BH, Lam KY & Wan KY 2006 Classical and follicular variant of papillary thyroid carcinoma: a comparative study on clinicopathologic features and long-term outcome. World Journal of Surgery 30 752–758.[CrossRef][Web of Science][Medline]
Lupi C, Giannini R, Ugolini C, Proietti A, Berti P, Minuto M, Materazzi G, Elisei R, Santoro M, Miccoli P et al. 2007 Association of BRAF V600E mutation with poor clinicopathologic outcomes in 500 consecutive cases of papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism 92 4085–4090.
Maeta H, Ohgi S & Terada T 2001 Protein expression of matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinase 1 and 2 in papillary thyroid carcinomas. Virchows Archiv 438 121–128.[CrossRef][Web of Science][Medline]
Melillo RM, Castellone MD, Guarino V, De Falco V, Cirafici AM, Salvatore G, Caiazzo F, Basolo F, Giannini R, Kruhoffer M et al. 2005 The RET/PTC-RAS-BRAF linear signaling cascade mediates the motile and mitogenic phenotype of thyroid cancer cells. Journal of Clinical Investigation 115 1068–1081.[CrossRef][Web of Science][Medline]
Mesa C Jr, Mirza M, Mitsutake N, Sartor M, Medvedovic M, Tomlinson C, Knauf JA, Weber GF & Fagin JA 2006 Conditional activation of RET/PTC3 and BRAFV600E in thyroid cells is associated with gene expression profiles that predict a preferential role of BRAF in extracellular matrix remodeling. Cancer Research 66 6521–6529.
Mitsiades CS, Negri J, McMullan C, McMillin DW, Sozopoulos E, Fanourakis G, Voutsinas G, Tseleni-Balafouta S, Poulaki V, Batt D et al. 2007 Targeting BRAFV600E in thyroid carcinoma: therapeutic implications. Molecular Cancer Therapeutics 6 1070–1078.
Nakamura N, Carney JA, Jin L, Kajita S, Pallares J, Zhang H, Qian X, Sebo TJ, Erickson LA & Lloyd RV 2005 RASSF1A and NORE1A methylation and BRAFV600E mutations in thyroid tumors. Laboratory Investigation 85 1065–1075.[CrossRef][Medline]
Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T & Yamashita S 2003 Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. Journal of Clinical Endocrinology and Metabolism 88 4393–4397.
Nikiforov YE 2002 RET/PTC rearrangement in thyroid tumors. Endocrine Pathology 13 3–16.[CrossRef][Web of Science][Medline]
Nikiforov YE 2004 Genetic alterations involved in the transition from well-differentiated to poorly differentiated and anaplastic thyroid carcinomas. Endocrine Pathology 15 319–327.[CrossRef][Web of Science][Medline]
Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A et al. 2003 BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. Journal of Clinical Endocrinology and Metabolism 88 5399–5404.
Nikiforova MN, Ciampi R, Salvatore G, Santoro M, Gandhi M, Knauf JA, Thomas GA, Jeremiah S, Bogdanova TI, Tronko MD et al. 2004 Low prevalence of BRAF mutations in radiation-induced thyroid tumors in contrast to sporadic papillary carcinomas. Cancer Letters 209 1–6.[CrossRef][Web of Science][Medline]
Oler G, Ebina KN, Michaluart P Jr, Kimura ET & Cerutti J 2005 Investigation of BRAF mutation in a series of papillary thyroid carcinoma and matched-lymph node metastasis reveals a new mutation in metastasis. Clinical Endocrinology 62 509–511.[CrossRef][Medline]
Palona I, Namba H, Mitsutake N, Starenki D, Podtcheko A, Sedliarou I, Ohtsuru A, Saenko V, Nagayama Y, Umezawa K et al. 2006 BRAFV600E promotes invasiveness of thyroid cancer cells through nuclear factor
B activation. Endocrinology 147 5699–5707.
Park SY, Park YJ, Lee YJ, Lee HS, Choi SH, Choe G, Jang HC, Park SH, Park do J & Cho BY 2006 Analysis of differential BRAF(V600E) mutational status in multifocal papillary thyroid carcinoma: evidence of independent clonal origin in distinct tumor foci. Cancer 107 1831–1838.
Pelizzo MR, Boschin IM, Toniato A, Pagetta C, Piotto A, Bernante P, Casara D, Pennelli G & Rubello D 2004 Natural history, diagnosis, treatment and outcome of papillary thyroid microcarcinoma (PTMC): a mono-institutional 12-year experience. Nuclear Medicine Communications 25 547–552.[CrossRef][Web of Science][Medline]
Pellegriti G, Scollo C, Lumera G, Regalbuto C, Vigneri R & Belfiore A 2004 Clinical behavior and outcome of papillary thyroid cancers smaller than 1.5 cm in diameter: study of 299 cases. Journal of Clinical Endocrinology and Metabolism 89 3713–3720.
Penko K, Livezey J, Fenton C, Patel A, Nicholson D, Flora M, Oakley K, Tuttle RM & Francis G 2005 BRAF mutations are uncommon in papillary thyroid cancer of young patients. Thyroid 15 320–325.[CrossRef][Web of Science][Medline]
Peyssonnaux C & Eychene A 2001 The Raf/MEK/ERK pathway: new concepts of activation. Biology of the Cell 93 53–62.[CrossRef][Web of Science][Medline]
Powell N, Jeremiah S, Morishita M, Dudley E, Bethel J, Bogdanova T, Tronko M & Thomas G 2005 Frequency of BRAF T1796A mutation in papillary thyroid carcinoma relates to age of patient at diagnosis and not to radiation exposure. Journal of Pathology 205 558–564.[CrossRef][Web of Science][Medline]
Puxeddu E, Moretti S, Giannico A, Martinelli M, Marino C, Avenia N, Cristofani R, Farabi R, Reboldi G, Ribacchi R et al. 2003 Ret/PTC activation does not influence clinical and pathological features of adult papillary thyroid carcinomas. European Journal of Endocrinology 148 505–513.[Abstract]
Puxeddu E, Moretti S, Elisei R, Romei C, Pascucci R, Martinelli M, Marino C, Avenia N, Rossi ED, Fadda G et al. 2004 BRAFV599E mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. Journal of Clinical Endocrinology and Metabolism 89 2414–2420.
Quiros RM, Ding HG, Gattuso P, Prinz RA & Xu X 2005 Evidence that one subset of anaplastic thyroid carcinomas are derived from papillary carcinomas due to BRAF and p53 mutations. Cancer 103 2261–2268.[CrossRef][Web of Science][Medline]
Regalbuto C, Squatrito S, La Rosa GL, Cercabene G, Ippolito A, Tita P, Salamone S & Vigneri R 1996 Longitudinal study on goiter prevalence and goitrogen factors in northeastern Sicily. Journal of Endocrinological Investigation 19 638–645.[Medline]
Riesco-Eizaguirre G, Gutierrez-Martinez P, Garcia-Cabezas MA, Nistal M & Santisteban P 2006 The oncogene BRAF V600E is associated with a high risk of recurrence and less differentiated papillary thyroid carcinoma due to the impairment of Na+/I– targeting to the membrane. Endocrine-Related Cancer 13 257–269.
Rodolico V, Cabibi D, Pizzolanti G, Richiusa P, Gebbia N, Martorana A, Russo A, Amato MC, Galluzzo A & Giordano C 2007 BRAF(V600E) mutation and p27(kip1) expression in papillary carcinomas of the thyroid 1 cm and their paired lymph node metastases. Cancer 110 1218–1226.
Rosenbaum E, Hosler G, Zahurak M, Cohen Y, Sidransky D & Westra WH 2005 Mutational activity of BRAF is not a major event in sporadic childhood papillary thyroid carcinoma. Modern Pathology 18 898–902.[CrossRef][Web of Science][Medline]
Santoro M, Carlomagno F, Hay ID, Herrmann MA, Grieco M, Melillo R, Pierotti MA, Bongarzone I, Della Porta G, Berger N et al. 1992 Ret oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype. Journal of Clinical Investigation 89 1517–1522.[Web of Science][Medline]
Santoro M, Melillo RM, Carlomagno F, Fusco A & Vecchio G 2002a Molecular mechanisms of RET activation in human cancer. Annals of the New York Academy of Sciences 963 116–121.[Web of Science][Medline]
Santoro M, Papotti M, Chiappetta G, Garcia-Rostan G, Volante M, Johnson C, Camp RL, Pentimalli F, Monaco C, Herrero A et al. 2002b RET activation and clinicopathologic features in poorly differentiated thyroid tumors. Journal of Clinical Endocrinology and Metabolism 87 370–379.
Sapio MR, Posca D, Troncone G, Pettinato G, Palombini L, Rossi G, Fenzi G & Vitale M 2006 Detection of BRAF mutation in thyroid papillary carcinomas by mutant allele-specific PCR amplification (MASA). European Journal of Endocrinology 154 341–348.
Sedliarou I, Saenko V, Lantsov D, Rogounovitch T, Namba H, Abrosimov A, Lushnikov E, Kumagai A, Nakashima M, Meirmanov S et al. 2004 The BRAFT1796A transversion is a prevalent mutational event in human thyroid microcarcinoma. International Journal of Oncology 25 1729–1735.[Web of Science][Medline]
Tronko MD, Howe GR, Bogdanova TI, Bouville AC, Epstein OV, Brill AB, Likhtarev IA, Fink DJ, Markov VV, Greenebaum E et al. 2006 A cohort study of thyroid cancer and other thyroid diseases after the chornobyl accident: thyroid cancer in Ukraine detected during first screening. Journal of the National Cancer Institute 98 897–903.
Trovisco V, Vieira de Castro I, Soares P, Maximo V, Silva P, Magalhaes J, Abrosimov A, Guiu XM & Sobrinho-Simoes M 2004 BRAF mutations are associated with some histological types of papillary thyroid carcinoma. Journal of Pathology 202 247–251.[CrossRef][Web of Science][Medline]
Trovisco V, Soares P, Preto A, de Castro IV, Lima J, Castro P, Maximo V, Botelho T, Moreira S, Meireles AM et al. 2005 Type and prevalence of BRAF mutations are closely associated with papillary thyroid carcinoma histotype and patients' age but not with tumour aggressiveness. Virchows Archiv 446 589–595.[CrossRef][Web of Science][Medline]
Vasko V, Ferrand M, Di Cristofaro J, Carayon P, Henry JF & de Micco C 2003 Specific pattern of RAS oncogene mutations in follicular thyroid tumors. Journal of Clinical Endocrinology and Metabolism 88 2745–2752.
Vasko V, Hu S, Wu G, Xing JC, Larin A, Savchenko V, Trink B & Xing M 2005 High prevalence and possible de novo formation of BRAF mutation in metastasized papillary thyroid cancer in lymph nodes. Journal of Clinical Endocrinology and Metabolism 90 5265–5269.
Vigneri R 1988 Studies on the goiter endemia in Sicily. Journal of Endocrinological Investigation 11 831–843.[Medline]
Xing M 2005 BRAF mutation in thyroid cancer. Endocrine-Related Cancer 12 245–262.
Xing M 2007 BRAF mutation in papillary thyroid cancer: pathogenic role, molecular bases, and clinical implications. Endocrine Reviews 28 742–762.
Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, Carson KA, Vasko V, Larin A, Tallini G et al. 2005 BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 90 6373–6379.
Zwi LJ & LiVolsi VA 2002 Hurthle cell carcinoma arising from thyroid papillary carcinoma. Endocrine Pathology 13 213–217.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
M. Xing, D. Clark, H. Guan, M. Ji, A. Dackiw, K. A. Carson, M. Kim, A. Tufaro, P. Ladenson, M. Zeiger, et al. BRAF Mutation Testing of Thyroid Fine-Needle Aspiration Biopsy Specimens for Preoperative Risk Stratification in Papillary Thyroid Cancer J. Clin. Oncol., June 20, 2009; 27(18): 2977 - 2982. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Guan, M. Ji, R. Bao, H. Yu, Y. Wang, P. Hou, Y. Zhang, Z. Shan, W. Teng, and M. Xing Association of High Iodine Intake with the T1799A BRAF Mutation in Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1612 - 1617. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |