|
|
||||||||
From the Minigene Pharmacy Laboratory of the Biopharmaceutical College, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009, People's Republic of China
(Correspondence should be addressed to C Rongyue; Email: caoronguenanjing{at}yahoo.com.cn)
| Abstract |
|---|
|
|
|---|
, were developed in mice immunized with HG6 when compared with HSP65 or PBS. We found that immunogene tumor therapy with a vaccine based on GRP was effective at both protective and therapeutic antitumor immunity in breast tumor models in mice. The purified GRP monoclonal antibody (McAb) was proved to be potential in inhibiting EMT-6 tumor cell proliferation in vitro. The attenuation induced by active immune responses on tumor-induced angiogenesis was observed with an intradermal tumor model in mice. Taken together, we demonstrate for the first time that immune responses that are elicited by a novel chimeric protein vaccine targeting GRP can suppress the proliferation of breast tumor cell EMT-6 in mice, and it may be of importance in the further exploration of the applications of other autocrine growth factor identified in human and other animal in cancer therapy.
| Introduction |
|---|
|
|
|---|
When compared with the previous GRPR antagonists or monoclonal antibody, vaccines targeting GRP have dual advantages: first, high titer of antibodies evoked by cancer vaccine can act as receptor antagonists to block GRPR activation; secondly, during vaccination, the activation of tumor-specific T lymphocytes can be induced. Thus, the induction of a strong and long-lasting immunity characterized by humoral and cell-mediated immune responses is one of the most important considerations for developing effective antitumor vaccines. But a key problem in developing subunit vaccines is that the immunogenicity of the vaccines is weak. Previous studies have demonstrated that mycobacterial 65 kDa heat shock proteins (HSP65) exhibit strong immunogenicity and contain strong T-cell epitopes presented by major histocompatibility II molecules, and accordingly they have been used as helper T-cell epitopes for delivering B-cell epitopes in vivo (Perraut et al. 1993). Thus, HSP65 can be used as suitable and safe carrier molecules for delivering B-cell epitopes to the immune system in vivo in the absence of adjuvants (Barrios et al. 1994). Another convenient feature of HSP65 as a carrier is its ability to enhance the molecular weight of incomplete antigen, like self-peptide GRP, and then effective immune response can be evoked. Besides, the low immunogenicity of self-peptides can also be overcome by immunization with immunogens containing multiple copies of the self-peptides in linear alignment. It has been shown that tandemly repeated epitopes are able to efficiently induce a strong immune response in vivo (Kim et al. 2005, Yi et al. 2006) and prime CD4+T cells in vitro (Barratt-Boyes et al. 1999).
In this study, we fused the strong helper T-cell epitope carrier molecule of HSP65 with the tandemly repeated epitopes of GRP and tested whether the fusion protein can induce strong humoral and cell-mediated immune responses after injection into mice. Moreover,we investigated whether recombinant protein has a protective effect as a vaccine before tumor cell challenge. In addition, we applied the same strategy for a therapeutic approach to assess the efficacy against established tumors. Furthermore, the inhibition induced by active immune responses on tumor-induced angiogenesis was evaluated with an intradermal tumor model in mice.
| Materials and methods |
|---|
|
|
|---|
The recombinant plasmid was constructed according to the method described by Yankai et al. (2006) with slight modifications. Briefly, two copies of the GRP-10 gene were inserted, marked as (GRP-10)2, into the plasmid pET28a-HSP65 behind the gene of HSP65 three times to form tandemly repeated epitopes. The encoding sequence of (GRP-10)2 was synthesized by PCR with two oligonucleotides used as both primers and templates: P1 (5'CGGGCTAGCGGCAACCACTGGGCGGTGGGGCACTTAATGGGCAACCACTGGGCGGTG 3') as the forward primer; P2 (5'CCCAAGCTTATCTAGACATTAAGTGCCCCACCGCCCAGTGGTTGCCCATTAAGTGCCC 3') as the forward primer. The final correct sequence was verified by Invitrogen.
Expression and purification of the recombinant fusion protein
The Escherichia coli BL21 (DE3) containing pET28a-HSP65-(GRP-10)6, inoculated from a single bacterial colony, was grown for 10 h at 37 °C. The preculture was diluted 50-fold in LB medium containing kanamycin (50 µg/ml), and then grown at 37 °C. The recombinant engineering bacteria including HG6 was induced at A550 of 1.3–1.5 by addition of lactose to a final concentration of 5 mM. When harvested after 6 h induction, the bacteria were suspended in buffer of 50 mM Tris–HCl pH 8.0 and lysed with 40 µg/ml lysozyme in the presence of 1 U/ml DNaseI at 37 °C for 1 h. Centrifugation was carried out at 12 000 g for 20 min at 4 °C. The HG6 in the supernatant was precipitated with 10% saturated ammonium sulfate. The purified protein was stored at –20 °C after being lyophilized.
Immunization procedure
Five-week-old BALB/c mice of three groups were immunized subcutaneously in the right flank with HG6, HSP65, or PBS (control; 50 µg per mouse). Sera were collected weekly for immunoassay after the initial immunization.
ELISA analysis for GRP antibody
An ELISA was performed to detect the GRP antibody level as described elsewhere (Ghosh & Jackson 1999). Briefly, 96-well flat-bottomed ELISA plates (Costar, Kennebunk, ME, USA) were coated with 100 µl/well of recombinant green fluorescent protein (GFP)-(GRP-10) proteins (10 µg/well) and kept overnight at 4 °C. Plates were blocked with PBS containing 5% (w/v) bovine serum albumin (BSA; Sigma) and then incubated with 100 µl/well 1:100 dilution of serum collected from immunized animals. A secondary HRP-conjugated goat anti-mouse IgG (Sigma) was used for the substrate reaction. The absorbance measured at a wavelength of 450 nm is proportional to the GRP-specific IgG titer within the sera. Each measurement was carried out in duplicate.
Western blot analysis
Western blot analysis was performed as described (Gaofu et al. 2004). Briefly, recombinant proteins were electrophoresed on a 15% SDS-PAGE gel and then were transferred to nitrocellulose membrane (Millipore, Bedford, MA, USA). The membrane was blocked with 5% BSA, washed and probed with mice sera at 1:200. Blots were then washed and incubated with HRP-conjugated goat anti-mouse IgG (Sigma). After the membrane was washed again, reaction was developed using 0.05% (w/v) 3,30,5,50-diaminobenzidine and 0.012% (v/v) H2O2 for 15 min at 37 °C. Recombinant proteins GFP-(GRP-10) with the GFP as fusion partner and HSP65 were expressed and purified from E. coli (Gaofu et al. 2004).
Preparation of GRP McAb and its inhibition of tumor cell proliferation in vitro
The GRP monoclonal antibodies (McAb) were prepared as per previous methods (Hendriksen & de Leeuw 1998). Briefly, BALB/c mice were immunized with recombinant protein HG6. Then spleen cells from the immunized mice were fused with SP2/0 myeloma cells to get hybridoma cells. Ascites from the mice vaccinated with hybridoma cells were collected and GRP monoclonal antibodies were purified through affinity chromatography.
The efficacy of GRP McAb in antitumor in vitro was tested by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) dye assay according to the method described by Bounous & Brown (1992) with slight modifications. Briefly, EMT-6 cells were cultured and transferred to 96-well cell culture plate with 1x104 cells per well and then incubated with serially diluted GRP McAb. After 48 h of incubation, 20 µl MTT were added to each well and plates were incubated for further 4 h. At the end of the incubation, the plates were read at 570 nm.
Lymphocyte proliferative response
Mouse splenocytes were prepared as follows. Spleens were removed from the immunized mice and were homogenized in PBS (pH 7.4).The erythrocytes cell suspension was lysed with 0.75% Tris–NH4Cl (pH 7.4). After being washed three times with PBS, the splenocytes were resuspended at 2x106 cells/ml with the supplemented RPMI 1640 containing 10% fetal bovine serum, 14 mM HEPES, 50 mM 2-mercaptoethanol, 100 µg/ml streptomycin, and 100 IU/ml penicillin. Splenocytes were plated in 96-well flat-bottom plates at 100 µl per well (2x105 cells per well). Subsequently, 100 µl per well of medium with HG6, HSP65 (10 µg/ml), or PBS were added and mixed. Concanavalin A (1.25 µg/ml; Sigma) was used as a positive control. Each splenocyte sample was plated in triplicate. The proliferative response was measured by MTT dye assay according to the method described previously. Briefly, after 72 h of incubation, 20 µl MTT were added to each well and plates were incubated for a further 4 h. At the end of the incubation, the plates were read at 570 nm.
INF-
release assays
T lymphocytes were prepared, cultured, and stimulated as described earlier (Julius et al. 1973). After incubation for 72 h, culture supernatants were harvested to test the presence of INF-
. Commercially available mouse INF-
ELISA kits (PharMingen, San Diego, CA, USA) were used according to the manufacturer's instructions.
Quantification of angiogenesis in vivo
To visualize the induction of angiogenesis by a tumor in vivo, an intradermal tumor model was used. In this model, neovasculature observed predominantly at the tumor periphery can be quantified by vessel counting (Kreisle & Ershler 1988, Auerbach et al. 1991). Three groups of BALB/c mice (three mice each group) were immunized with PBS, HSP65, or HG6, respectively, for four times at biweekly intervals. At 2 weeks after the final vaccination, mice were anesthetized (inhalant 4% Halothane-vet) and 106 EMT-6 mouse breast tumor cells in 50 µl PBS were implanted intradermally at two sites in the abdominal region. Two additional injections of PBS (50 µl) were performed on each mouse as a control. All implant sites were marked with indelible ink to aid identification at the end of the experiment. After 7 days, a section of the abdominal wall skin encompassing all implant sites was removed and spread onto filter paper. Sections were examined by light microscopy (x10 magnification) and the total number of blood vessels (major vessels and branching points) was determined within a 1 cm2 area around each implant site. Vessel counts from implants of PBS were consistent irrespective of treatment; the mean value was therefore subtracted from control and vaccines immunized vessel counts to give a more accurate indication of tumor-induced blood vessel formation and to ascertain the effect of treatment.
Statistical analysis
Data were shown as mean±S.E.M. Student's t-test was used in the analysis of data for statistical significance.
| Results |
|---|
|
|
|---|
The native GRP is normally present in mammals, so it is not quite suitable for recombinant expression in bacterial cells. The two PCR primers used in the synthesis of the GRP gene were designed based on the genetic code rule in prokaryotes in order to express GRP gene in E. coli effectively. When two sites, which were digested by endonucleases NheI and XbaI respectively, as we knew they were isocaudamer, ligated again, the new site was recognized neither by NheI nor by XbaI. As a result, the plasmid pET28a-HSP65-(GRP-10)4 and pET28a-HSP65-(GRP-10)6 retained the site NheI only. With this strategy of isocaudamer technique, we construct the plasmid with six copies of GRP behind the gene of HSP65 (Fig. 1A and B).
|
Induction of prophylactic antitumor immunity
In order to analyze the protective effect of this vaccine on breast cancer, a vaccination protocol was designed as shown in Fig. 2A. Always a total of eight BALB/c mice were used for each experimental group. Mice were immunized subcutaneously four times at biweekly intervals, on day –56, –42, –28, and –14, with the same doses (50 µg per mouse) of HG6, HSP65, or PBS alone. At day 0, EMT-6 breast tumor cells (2x105) were injected subcutaneously into immunized mice. At day 14 after the cells challenged, all mice were killed and solid tumors were excised and weighed. As shown in Fig. 2B, tumors grew progressively in non-immunized mice (PBS alone) or in HSP65-immunized mice, but there was significant protection against tumor growth in HG6-immunized mice. In the group vaccinated with HG6, the mean mass of solid tumors was significantly less than the mean mass of solid tumors in the PBS (0.35±0.14 vs 1.037±0.28 g; P=0.0004) and HSP65 group (0.35±0.14 vs 0.907±0.103 g; P=0.0001). Vaccination with HG6 resulted in a three-fold reduction in tumor volume (360±120 mm3) when compared with HSP65 group (1000±102 mm3) and controls (1160±238 mm3, PBS; Fig. 2D).
|
More relevant to the treatment of tumor by vaccines is the therapeutic potential vaccines. Therefore, a therapeutic vaccination protocol was designed as shown in Fig. 3A. At day 0, EMT-6 breast tumor cells (2x105) were injected subcutaneously into three groups of mice. The therapeutic efficacy of vaccine HG6 was tested next in the established tumors. The mice were treated starting from day 3 after the injection of tumor cells, when the tumor was palpable. The mice were treated with HG6, HSP65, or PBS respectively in the dose of 50 µg per mouse on day 3, 10, 17 as indicated (Fig. 3A). At day 7 after the third treatment, all mice were killed and solid tumors were excised and weighed. Unexpectedly, one mouse from the PBS group died on day 20. The tumor volumes of the mice treated with vaccine HG6 were strongly reduced whereas the mice treated with PBS or HSP65 showed tumors of larger size (Fig. 3B). In the group vaccinated with HG6, the mean mass of solid tumors was significantly less than the mean mass of solid tumors in the PBS (1.02±0.34 vs 2.115±0.9 g; P=0.0079) and HSP65 group (1.02±0.34 vs 1.832±0.7 g; P=0.042; Fig. 3C).
|
Characterization of GRP-specific IgG from immunized mice sera
In order to investigate whether the chimeric vaccine containing tandem repeats of GRP epitope could evoke strong humoral immune response, we compared the levels of GRP-specific IgG in the sera collected from mice immunized with HG6, HSP65, and PBS (as control) respectively by ELISA (Fig. 4A). The HG6 group showed a greatly increasing titer of GRP-specific IgG measured by ELISA as early as the first week following initial vaccination, while mice that were vaccinated with HSP65 alone or with PBS failed to elicit antibody formation. Later, anti-GRP antibodies could easily be detected by ELISA till the last week.
|
Inhibition of tumor cells growth in vitro treated with GRP McAb
BALB/c mice were immunized with protein HG6 and then the spleen cells separated from the mice were fused into myeloma cells SP2/0 with the help of the fusogenic agent PEG to get hybridoma cells. Through the sandwich ELISA method, a cell strain of hybridoma cells were selected, which can excrete antibody with high affinity against GRP. Then rats were vaccinated with hybridoma cells and its ascites was collected to be purified through saturated ammonium sulfate precipitation and affinity chromatography. The valency was determined through the sandwich ELISA method to be 2x106. The affinity constant between GRP McAb and GRP was calculated to be 1.5x109. The antibody was tested with immunoglobulin subtype kit and found to be IgG1 Type
subtype.
To evaluate the inhibition effect of GRP McAb on EMT-6 cells in vitro, serially diluted GRP McAb (from 1/1024 µmol/l to 1 µmol/l) was added to tumor cells in a 96-well cell culture plate. The proliferation of EMT-6 cells in vitro was suppressed by GRP McAb as shown in Table 1. The effect was dose dependent. Treatment with a dose of 3x10–8 mol/l McAb had significant inhibition on tumor cells growth compared with that of the controls (IR%=17.3%; P<0.01). With the dose of McAb increasing to 1x10–6 mol/l, tumor cells were inhibited more significantly and the inhibition rate reached 47.2%. Upon further study, the phenomenon of cell apoptosis was observed when tumor cells were treated with a higher concentration of McAb.
|
Although humoral immune responses were induced by vaccine HG6, it provided more efficient protective and therapeutic effect on mice against breast tumor, suggesting that the level of antibodies present in immunized animals do not correlate fully with antitumor results. Thus, we speculated that cell-mediated immunity also contributes to antitumor effect and this vaccine may induce stronger cellular immune responses. To test this hypothesis, another three groups of mice (four mice in each group) were immunized with PBS, HSP65, or HG6 as described earlier. Lymphocyte proliferative responses were analyzed 2 weeks after final immunization. As shown in Fig. 5, similar to the humoral immune responses, the GRP-specific proliferative response was significantly higher (P<0.05) in mice immunized with HG6 than in mice immunized with HSP65 as well as the controls. Low levels of lymphocyte proliferative responses were observed in controls groups. Interestingly, the data presented that the response in lymphocyte from HSP65-immunized mice were even lower than that from PBS injected mice, suggesting that HSP65 have the function of down-regulation on immune system. Further researches on HSP65 were warranted.
|
in the supernatant of antigen-stimulated T lymphocyte from immunized mice's spleen was assessed. As shown in Fig. 6, the amount of INF-
measured in the supernatants of T lymphocyte from PBS-immunized mice stimulated with different antigen including ConA, PBS, HSP65, or HG6 exhibited no significant difference. Similar results were showed in T lymphocyte from HSP65 group mice. However, the release of INF-
measured in the supernatants of T lymphocyte from HG6-immunized mice stimulated with different antigen was significantly higher than the levels of INF-
measured in mice immunized with HSP65 and PBS (P<0.01). This result was consistent with that of lymphocyte proliferative responses. These INF-
release results indicate that HG6 had induced an enhanced Th1-type cell immune response.
|
To assess the effect of immune response on tumor angiogenesis induced by vaccine HG6, three groups of mice (three mice each group) were immunized with PBS, HSP65, or HG6, respectively, as described earlier. The EMT-6 tumor cells were implanted intradermally at two sites in the abdominal region, 14 days after final immunization. As shown in Fig. 7, tumor cells implanted intradermally were found to induce significant angiogenesis within a period of 7 days. The total number of blood vessels around each implant site from HG6-immunized mice was significantly lower than blood vessels from PBS (37±4 vs 125±18; P<0.001) and HSP65-immunized mice (37±4 vs 113±17; P<0.001).
|
| Discussion |
|---|
|
|
|---|
The characteristics of this novel protein vaccine may contribute to its efficacy in the inhibition of tumor growth. First, this vaccine contains six tandem repeats of a 10-amino acid residue epitope of GRP. The induction of an immune response against self-peptides is problematic because of its low immunogenicity. Hsu et al. (2000) developed a new and efficient delivery system with the approach termed template-repeated polymerase chain reaction (TR-PCR) to induce an immune response against poorly immunogenic plasma peptides. They used multiple repeats of a small self-peptide (12 repeats of 10 amino acid residues of gonadotropin-releasing hormone) fused to the receptor binding domain (Ia) of Pseudomonas exotoxin A as an immunogen, which could evoke high-titer antibodies specific to the hormone in female rabbits. In this study, we take another approach to increase the copy number of self-peptide with the strategy of isocaudamer technique. With this efficient method, we can not only multiply a single kind of epitope but also tandemly link different kinds of epitopes to construct a multivalent vaccine. Our results showed that the introduction of six copies of a 10-amino acid residue sequence played a key role in enhancing the immunogenicity and antitumor effects of the fusion protein vaccine, which was more like the results of Kim et al. (2005) in that the low immunogenicity seemed to be overcome due to the tandem repeats. On the other hand, HSP65 may also play another important part in enhancing the immunogenicity of the vaccine in this study. According to the earlier literature, is able HSP65 to: (1) chaperone peptides, including antigenic peptides (Tamura et al. 1997, Srivastava et al. 1998); (2) interact with antigen presenting cells through a receptor (Arnold-Schild et al. 1999, Basu et al. 2001); (3) stimulate antigen-presenting cells to secrete inflammatory cytokines (Cho et al. 2000, Ausiello et al. 2006); (4) mediate maturation of dendritic cells, making them a one-stop shop for the immune system (Cho et al. 2000, Ausiello et al. 2006); and (5) help HSP fusion protein elicit cytolytic T lymphocytes activity (Anthony et al. 1999). With such kinds of feature, HSP can assist the fusion protein to successfully induce a strong immune response including humoral and cell immunity.
The mechanisms underlying the ability of HG6 fusion protein to inhibit the proliferation of EMT-6 tumor cells in vivo have yet to be elucidated. First, it is clear that the humoral immune response has been elicited by the vaccination of this protein with high titer of GRP-specific antibodies detected. This phenomenon suggests that GRP-specific antibodies may neutralize the self-peptide GRP secreted by tumor cells and lower the concentration of GRP in tumor circumstances, for the activation of GRPR may be interrupted and the successive signal pathway can be blocked. Secondly, the antitumor result may be the synergistic effect of HSP65. Ausiello et al. (2006) have suggested that HSP65 could induce a strong monocyte-derived dendritic cells (MDDC) maturation. A clear T helper (Th) 1 immune response was also induced by HSP65 with the secretion of regulatory cytokines and enhancement of antigen presenting ability of mature MDDC. Our results show that the mice immunized with the native HSP65 also exhibit an extent of suppression on the tumor cells. The phenomenon may be explained by the fact that helper T cells induced by HSP65 can secrete a series of cytokines including INF-
and interleukin (IL)-2, which will stimulate the switching of natural killer cells (NK cells) to lymphokine activated killer cells (LAK cells) with enhanced nonspecific antitumor response. Thirdly, a putative effect of controlling tumor growth may come from the complement system. With the neutralization to the GRP by the GRP-specific antibodies, a large number of immune complexes will be produced, which may activate the complement cascade. The complement-mediated lysis of tumor cells can be enhanced by amplification of the amount of antibodies during the period of GRP secreted and released from the surface of tumor cell membranes.
It is known that CD4+T lymphocytes can steer and amplify immune responses through the secretion of cytokines and expression of surface molecules (Romagnani 1997, Schwartz 1997) and play a key role in antitumor immunity for establishing long-lasting and memory lymphocytes. Wei et al. (2001) have demonstrated that mice depleted of CD4+T lymphocytes by the injection of anti-CD4 McAb and vaccinated with Xenopus vascular endothelial growth factor (VEGF) were not protected from tumor challenge. In contrast, treatment with anti-CD8 or anti-NK McAb or control IgG failed to abrogate the antitumor activity. Nawrath et al. (2001) have reported that CD4-depleted mice, vaccinated with DNA encoding gp100 and pps cells, did not benefit from vaccination. The survival rate of all of the mice challenged malignant melanoma declined rapidly. In the present study, we found that proliferative responses in vitro of lymphocytes from HG6-immunized mice were induced notably and production of INF-
from these T lymphocytes was enhanced significantly. These findings suggest that active CD4+T lymphocytes are absolutely essential for antitumor activity.
An important early event in the development of cancer is the induction of genes regulating angiogenesis, which is thought to be necessary for all macroscopic solid tumor growth. Several previous studies have demonstrated that GRP may contribute to the increased metastatic potential of cancers through the stimulation of proangiogenic gene expression. Lyuba Levine et al. (2003) have reported that GRP stimulation of GPR-R induced nuclear factor-kappa B (NF
B) activation and up-regulation of IL-8 gene expression in DU-145 and PC-3 cells, and increased VEGF gene expression in PC-3 cells. They also showed that GRP treatment of PC-3 cells induced I
B degradation, NF
B translocation to the cell nucleus, increased NF
B binding to its DNA consensus sequence, increased IL-8 and VEGF mRNA expression, and increased protein secretion. Kang et al. (2007) have showed that GRP is a tropic factor for highly vascular neuroblastomas with increased expression of angiogenic markers, PECAM-1 and VEGF, as well as phosphorylated (p)-Akt levels. Thus, GRP/GRPR is a potential target for inhibiting solid tumor growth by suppressing angiogenesis. It has been demonstrated that GRP or GRPR silencing significantly inhibited VEGF as well as p-Akt and p-mTOR expression in vitro, and inhibition of BBS/GRP with an antagonist, RC-3095, suppressed tumor progression and vascularization (Kang et al. 2007). Martinez et al. (2005) also reported that the specific GRP blocker 77 427 significantly reduced endothelial cell cord formation in vitro and angiogenesis in vivo. In our current study, we show that immune responses induced by vaccine HG6 significantly reduced angiogenesis and solid tumor proliferation when compared with controls in BALB/c model. It is suggested that high and GRP-specific antibodies evoked by HG6 might block the stimulation from GRP to GRPR and expression of proangiogenic gene, contributing to the inhibition of tumor growth in vivo.
In summary, we developed a novel protein vaccine consisting of six tandemly repeated GRP epitopes with the mycobacterial HSP65 as a carrier and first showed efficient control of the growth of breast cancer. HG6 has the potential to be developed as a suitable vaccine against various cancers.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Arnold-Schild D, Hanau D, Spehner D, Schmid C, Rammensee HG, de la Salle H & Schild H 1999 Cutting edge: receptor-mediated endocytosis of heat shock proteins by professional antigen-presenting cells. Journal of Immunology 162 3757–3760.
Auerbach R, Auerbach W & Polakowski I 1991 Assays for angiogenesis: a review. Pharmacology and Therapeutics 51 1–11.[CrossRef]
Ausiello CM, Fedele G, Palazzo R, Spensieri F, Ciervo A & Cassone A 2006 60-kDa heat shock protein of Chlamydia pneumoniae promotes a T helper type 1 immune response through IL-12/IL-23 production in monocyte-derived dendritic cells. Microbes and Infection 8 714–720.[CrossRef][Medline]
Barratt-Boyes SM, Vlad A & Finn O 1999 Immunization of chimpanzees with tumor antigen MUC1 mucin tandem repeat peptide elicits both helper and cytotoxic T-cell responses. Clinical Cancer Research 5 1918–1924.
Barrios C, Tougne C, Polla BS, Lambert PH & Del Giudice G 1994 Specificity of antibodies induced after immunization of mice with the mycobacterial heat shock protein of 65 kD. Clinical and Experimental Immunology 98 224–228.[Web of Science][Medline]
Basu S, Binder RJ, Ramalingam T & Srivastava PK 2001 CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 14 303–313.[CrossRef][Medline]
Battey JF, Way JM, Corjay MH, Shapira H, Kusano K, Harkins R, Wu JM, Slattery T, Mann E & Feldmani RI 1991 Molecular cloning of the bombesin/gastrin-releasing peptide receptor from Swiss 3T3 cells. PNAS 88 395–399.
Benya RV, Kusui T, Pradhan TK, Battey JF & Jensen RT 1995 Expression and characterization of cloned human bombesin receptors. Molecular Pharmacology 47 10–20.[Abstract]
Bounous DI & Brown J 1992 Comparison of MTT colorimetric assay and tritiated thymidine uptake for lymphocyte proliferation assays using chicken splenocytes. Avian Diseases 3 1022–1027.
Carroll RC, Matkowskyj KA, Chakrabarti S, Mcdonald TJ & Benya RV 1999 Aberrant expression of gastrin-releasing peptide and its receptor by well-differentiated colon cancers in humans. American Journal of Physiology 276 G655–G665.[Web of Science][Medline]
Chaudhry A, Carrasquillo JA, Avis IL, Shuke N, Reynolds JC, Bartholomew R, Larson SM, Cuttitta F, Johnson BE & Mulshine JL 1999 Phase I and imaging trial of a monoclonal antibody directed against gastrin-releasing peptide in patients with lung cancer. Clinical Cancer Research 5 3385–3393.
Cho BK, Palliser KD, Guillen KE, Wisniewski J, Young RA, Chen JZ & Eisen HN 2000 A proposed mechanism for the induction of cytotoxic T lymphocyte production by heat shock fusion proteins. Immunity 12 263–272.
Erspamer V, Erspamer GF, Inslevini M & Negri L 1972 Occurrence of bombesin and alytesin in extracts of the skin of three European discoglossid frogs and pharmacological actions of bombesin on extravascular smooth muscle. British Journal of Pharmacology 45 333–348.[Web of Science][Medline]
Gaofu Q, Dan M, Jie W, Liao Z, Li Z, Roque RS & Jingjing L 2004 Long-lasting specific antibodies against CETP induced by subcutaneous and mucosal administration of a 26-amino acid CETP epitope carried by heat shock protein 65 kDa in the absence of adjuvants. Vaccine 22 3187–3194.[CrossRef][Medline]
Ghosh S & Jackson DC 1999 Antigenic and immunogenic properties of totally synthetic peptide-based anti-fertility vaccines. International Immunology 11 1103–1110.
Hendriksen CFM & de Leeuw W 1998 Production of monoclonal antibodies by the ascites method in laboratory animals. Research in Immunology 149 535–542.[CrossRef][Medline]
Hsu CT, Ting CY, Ting CJ, Chen TY, Lin CP, Whang-Peng J & Hwang J 2000 Vaccination against gonadotropin-releasing hormone (GnRH) using toxin receptor-binding domain-conjugated GnRH repeats. Cancer Research 60 3701–3705.
Julius MH, Simpson E & Herzenberg RA 1973 A rapid method for the isolation of functional thymus-derived murine lymphocytes. European Journal of Immunology 3 645–649.[Web of Science][Medline]
Kang JH, Ishola TA, Baregamian N, Mourot JM, Rychahou PG, Mark Evers B & Chung DH 2007 Bombesin induces angiogenesis and neuroblastoma growth. Cancer Letters 253 273–281.[CrossRef][Medline]
Kim HD, Maxwell JA, Kong FK, Tang DC & Fukuchi K 2005 Induction of anti-inflammatory immune response by an adenovirus vector encoding 11 tandem repeats of Abeta1-6: toward safer and effective vaccines against Alzheimer's disease. Biochemical and Biophysical Research Communications 336 84–92.[CrossRef][Web of Science][Medline]
Kreisle RA & Ershler WB 1988 Investigation of tumor angiogenesis in an id mouse model: role of host–tumor interactions. Journal of National Cancer Institute 26 849–854.
Levine L, Lucci JA, Pazdrak B, Cheng JZ, Guo YS, Townsend CM & Hellmich MR 2003 Bombesin stimulates nuclear factor kappa B activation and expression of proangiogenic factors in prostate cancer cells. Cancer Research 63 3495–3502.
Martinez A, Zudaire E, Julian M, Moody TW & Cuttitta F 2005 Gastrin-releasing peptide (GRP) induces angiogenesis and the specific GRP blocker 77427 inhibits tumor growth in vitro and in vivo. Oncogene 24 4106–4113.[Medline]
Miyazaki M, Lamharzi N, Schally AV, Halmos G, Szepeshazi K, Groot K & Cai1 RZ 1998 Inhibition of growth of MDA-MB-231 human breast cancer xenografts in nude mice by bombesin/gastrin-releasing peptide (GRP) antagonists RC-3940-II and RC-3095. European Journal of Cancer 34 710–717.[CrossRef][Web of Science][Medline]
Moody TW, Jensen RT, Garcia-Marin L & Leyton J 2000 Nonpeptide neuromedin B receptor antagonists inhibit the proliferation of C6 cells. European Journal of Pharmacology 409 133–142.[CrossRef][Medline]
Moody TW, Leyton J, Garcia-Marin L & Jensen RT 2003 Nonpeptide gastrin releasing peptide receptor antagonists inhibit the proliferation of lung cancer cells. European Journal of Pharmacology 474 21–29.[CrossRef][Web of Science][Medline]
Nawrath M, Pavlovic J & Moelling K 2001 Synergistic effect of a combined DNA and peptide vaccine against gp100 in a malignant melanoma mouse model. Journal of Molecular Medicine 79 133–142.[CrossRef][Medline]
Perraut R, Lussow AR, Gavoille S, Garraud O, Matile H, Tougne C, van Embden J, van der Zee R, Lambert PH & Gysin J 1993 Successful primate immunization with peptides conjugated to purified protein derivative or mycobacterial heat shock proteins in the absence of adjuvants. Clinical and Experimental Immunology 93 382–386.[Medline]
Romagnani S 1997 The Th1/Th2 paradigm. Immunology Today 18 263–266.[Web of Science][Medline]
Schwartz RH 1997 T cell clonal anergy. Current Opinion in Immunology 9 351–357.[CrossRef][Web of Science][Medline]
Scott N, Millward E, Cartwright EJ, Preston SR & Coletta PL 2004 Gastrin releasing peptide and gastrin releasing peptide receptor expression in gastrointestinal carcinoid tumours. Journal of Clinical Pathology 57 189–192.
Srivastava PK, Menoret A, Basu S, Binder RJ & McQuade KL 1998 Heat shock proteins come of age: primitive functions acquire new roles in an adaptive world. Immunity 6 657–665.
Tamura Y, Peng P, Liu K, Daou M & Srivastava PK 1997 Immunotherapy of tumors with autologous tumor-derived heat shock protein preparations. Science 278 117–120.
Wei YQ, Huang MJ, Yang L, Zhao X, Tian L, Lu Y, Shu JM & Lu CJ 2001 Immunogene therapy of tumors with vaccine based on Xenopus homologous vascular endothelial growth factor as a model antigen. PNAS 98 11545–11550.
Yankai Z, Rong Y, Yi H, Wentao L, Rongyue C, Ming Y, Taiming L, Jingjing L & Jie W 2006 Ten tandem repeats of beta-hCG 109–118 enhance immunogenicity and anti-tumor effects of beta-hCG C-terminal peptide carried by mycobacterial heat-shock protein HSP65. Biochemical and Biophysical Research Communications 345 1365–1371.[CrossRef][Medline]
Yi H, Rong Y, Yankai Z, Wentao L, Hongxia Z, Jie W, Rongyue C, Taiming L & Jingjing L 2006 Improved efficacy of DNA vaccination against breast cancer by boosting with the repeat beta-hCG C-terminal peptide carried by mycobacterial heat-shock protein HSP65. Vaccine 24 2575–2584.[CrossRef][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |