|
|
||||||||
Department of Surgical and Gastroenterological Sciences, University of Verona, Chirurgia B, Policlinico GB Rossi, Piazzale LA Scuro, 37134 Verona, Italy
1 Departments of Pathology,
2 Radiology and
3 Medicine and Public Health, University of Verona, Verona, Italy
(Requests for offprints should be addressed to M Falconi; Email: massimo.falconi{at}univr.it)
| Abstract |
|---|
|
|
|---|
5% (P=0.016), weight loss (P=0.006) and absence of abdominal pain (P=0.003) at diagnosis. Other clinical (age, gender and primary tumour resection) or pathological parameters (site, size and liver metastasis) lacked significant correlation with tumour progression. No difference in the amount of SSTR2 mRNA and protein or SSTR5 mRNA was found between tumours that were stable (n=5) and seven tumours that progressed (n=7). Treatment with long-acting release octreotide was associated with stabilization of disease and a good quality of life in 38% of patients. A Ki-67 index
5% and/or the presence of weight loss may justify more aggressive therapy without waiting for radiologically proven progression of disease.
| Introduction |
|---|
|
|
|---|
More than 80% NF-PEC express receptors for somatostatin (SMS) and may be easily identified by somatostatin receptor scintigraphy (octreoscan) (Reubi et al. 1990). Several studies, including three phase-II trials (Saltz et al. 1993, Arnold et al. 1996, Eriksson et al. 1997), reported frequent stabilization of the disease in progressive gastroenteropancreatic neuroendocrine tumours (Arnold et al. 1996, di Bartolomeo et al. 1996, Angeletti et al. 1999, Ricci et al. 2000, Aparicio et al. 2001, Panzuto et al. 2006). It is widely recognized that among the latter, NF-PEC has the worse prognosis and the shortest stabilization rate (Arnold et al. 1996, di Bartolomeo et al. 1996, Angeletti et al. 1999, Ricci et al. 2000, Aparicio et al. 2001, Panzuto et al. 2006).
The optimal treatment for advanced well-differentiated NF-PEC that are not suitable for radical surgery remains controversial (Oberg et al. 2004). Therapeutic options include SMS analogues (Kraenzlin et al. 1983, Saltz et al. 1993, Arnold et al. 1996, di Bartolomeo et al. 1996, Tomassetti et al. 1998, 2000, Angeletti et al. 1999, Ricci et al. 2000, Aparicio et al. 2001), chemotherapy with doxorubicin and streptozotocin (Murray-Lyon et al. 1968, Moertel et al. 1980, 1982, 1992, Cheng & Saltz 1999, Ramanathan et al. 2001, Delaunoit et al. 2004), chemoembolization (Ruszniewski & Malka 2000), and receptor-mediated radiotherapy (Paganelli et al. 2001, Waldherr et al. 2002).
Several clinical studies have evaluated the efficacy of SMS analogues in treatment of neuroendocrine tumours (Kraenzlin et al. 1983, Saltz et al. 1993, Arnold et al. 1996, di Bartolomeo et al. 1996, Tomassetti et al. 1998, 2000, Angeletti et al. 1999, Ricci et al. 2000, Aparicio et al. 2001, Panzuto et al. 2006). However, it is difficult to draw definitive conclusions and compare the results of these studies due to the heterogeneity of the patients enrolled. In fact, studies of therapeutic efficacies with SMS analogues have often included heterogeneous series of patients suffering from endocrine tumours with different anatomical sites of origin, functioning or nonfunctioning nature, and histological subtype. Additional confounding factors include the different timing for enrolment of patients (e.g. at diagnosis or with progressive disease (PD)) (Kraenzlin et al. 1983, Saltz et al. 1993, Arnold et al. 1996, di Bartolomeo et al. 1996, Tomassetti et al. 1998, 2000, Angeletti et al. 1999, Ricci et al. 2000, Aparicio et al. 2001). More importantly, follow-up information for NF-PEC treated with SMS analogues is available only for 18 patients, whose treatment started after documented progression of disease (di Bartolomeo et al. 1996, Angeletti et al. 1999, Tomassetti et al. 2000).
Here, we report a prospective single centre phase IV study restricted to octreoscan-positive well-differentiated nonfunctioning pancreatic endocrine carcinomas. Twenty-one consecutive patients were treated with long-acting release octreotide. All the patients were symptomatic, had either metastatic or bulky disease, and no previous therapy. Treatment with SMS analogues was started at diagnosis and continued until tumour progression was observed.
The aims of our phase IV study of the somatostatin analogue octreotide were (i) to determine the response rate, duration of response and overall survival of patients with advanced nonfunctioning pancreatic endocrine carcinomas expressing somatostatin receptors as demonstrated by octreoscan scintigraphy and (ii) to identify factors predictive of response to therapy.
| Materials and methods |
|---|
|
|
|---|
Patients with well-differentiated nonfunctioning PECs not suitable for radical surgery were enrolled after obtaining informed consent. The clinical study was single centre, prospective and not sponsored. All cases were classified according to the criteria established by the World Health Organization (Kloppel et al. 2004).
Inclusion criteria were positivity for somatostatin receptors upon octreoscan scintigraphy of all lesions visible by abdominal ultrasonography and CT scan. Exclusion criteria were previous chemotherapy or liver chemoembolization, pregnancy or life expectancy less than 6 months, and histological diagnosis of undifferentiated endocrine carcinoma.
The following parameters were recorded for each patient: age, sex, symptoms at diagnosis, serum neuron-specific enolase (NSE) and chromogranin A (CgA) (evaluated by IRMA SCHERING-CIS), tumour site and size, number and site of metastasis (liver, distant lymph nodes, lung and bone).
Tumour tissues were obtained from all patients either during intervention or by percutaneous needle biopsy under ultrasound guidance. Biopsies were fixed in formalin and paraffin-embedded as for routine diagnostic procedures. In 12 cases, more than one biopsy was obtained and the additional material was snap-frozen in liquid nitrogen and stored at 80 °C for RNA studies.
Expression of somatostatin receptors 2 and 5
The expression of somatostatin receptors 2 (SSTR2) and 5 (SSTR5) was assessed by quantitative RT-PCR in 12 patients for which frozen tissue was also available (12 primary tumours, three of which were with matched liver metastasis). ß-actin transcript levels were used for normalization and the SSTR2 and SSTR5 transcript levels of normal insulae of Langerhans were used as a control. Human islet preparations were obtained from pancreata of multiorgan donors obtained through the North Italian Transplant Organization using pancreas digestion according to the previously described automated procedures (Piemonti et al. 2002).
For tissue samples, RNA was prepared from 15 cryostat sections (40 µm thick) and checking the cellularity every five sections. Tissue sections were placed in 4 M guanidine thiocyanate containing 0.1 M 2-mercaptoethanol and centrifuged through a CsCl2 gradient. cDNAs were synthesized from 1 µg total RNA using random primers and the Superscript II reverse transcription kit (Invitrogen). Quantitative RT-PCR mRNA expression analysis was performed using an ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). PCRs contained 20 ng cDNA, 200 nM primers and 1x SYBR GREEN PCR Master Mix (Applied Biosystems) in a final volume of 25 µl. Sequences of primers used for PCR assays were: SSTR2-F, GTCCTCTGCTTGGTCAAGGTG and SSTR2-R, TGGTCTCATTCAGCCGGGATT; SSTR5-F, GCCTGGGTCCTGTCTCTGTG and SSTR5-R, TACCGCCCTCCTGCACGT; ß-actin-F, GGAGTCCTGTGGCATCCACG and ß-actin-R, CT-AGAAGCATTTGCGGTGGA. Calibration curves for each couple of primers were obtained by serial dilution of cDNA. Similar PCR efficiencies (calculated as 101/slope) were assumed; therefore, expression data were analysed by the comparative threshold cycle (Ct) method accordingly to User Bulletin #2 (Applied Biosystems). The Ct value is defined as the PCR cycle number at which the fluorescence generated from a sample reaches intensity appreciably above the background signal. Results were expressed in terms of the 
Ct value that represents the difference between the
Ct of the sample (
Cts) and the islet cells (
Cti).
Cts and
Cti are the difference in threshold cycle value between the target gene and the normalizer gene in the sample and the islet cells respectively. All experiments were performed in triplicate.
QRT-PCR data were expressed as relative to normal human pancreatic islet cells and the differences between the groups were evaluated by the MannWhitney test.
The expression of SSTR2 was also assessed by immunohistochemistry on formalin-fixed, paraffin-embedded material using an anti-SSTR2 antibody from Biotrend/Gramsch Laboratories (Schwabhausen, Germany) as described (Papotti et al. 2002). The tumour proliferative fraction was assessed by Ki-67 immunostaining as previously detailed, scanning at least 2000 neoplastic cells in randomly selected fields (Pelosi et al. 1996).
Somatostatin analogue treatment
Treatment consisted of an s.c. injection of octreotide (Sandostatina, SMS 201995, Sandoz, Basel, Switzerland), 100 µg thrice daily for 2 weeks, followed by an i.m. injection of octreotide acetate LAR (Novartis) at a dosage of 20 mg on day 14 and then every 28 days until PD was observed. The treatment was in accordance with the official indications of the Italian Ministry of Health (Note 40, Health Ministry CUF deliberation 7.8.1998).
Response and survival evaluation
All patients were monitored every 3 months with contrast enhanced CT scan, clinical evaluation of symptoms and body weight, measurement of blood parameters and tumour markers. According to the criteria of the WHO (Miller et al. 1981), PD was defined as an increase of
25% of the product of tumours largest perpendicular dimensions; stable disease (SD) as an increase <25% or a decrease within 50% of these measurements; and a partial response (PR) was considered as a decrease >50%. Biochemical response was defined as a CgA marker level reduction of
50%. Time to progression (TP) and survival were calculated from the first SMS analogue administration.
Statistical analysis
Continuous variables were expressed as median and interquartile range (IQR). Quantitative data were assessed using the MannWhitney U-test. Qualitative data were analysed with the
2-test using Yates correction and Fishers exact test when necessary. Survival and TP were analysed using KaplanMeier function and the Log-Rank test was used to verify differences between groups. All P values were two sided and considered significant when <0.05. All calculations were performed with SPSS 11.5 statistical package (SPSS, Chicago, IL, USA) and R software v. 2.1.1 and Survival package (http://www.R-project.org).
| Results |
|---|
|
|
|---|
|
Tumour response and progression free survival
Complete follow-up was obtained for all patients (ending October 2005). Two-, three- and five-year overall survival rates were 74.9, 74.9 and 52.4% respectively (Fig. 1
). Two-, three- and five-year progression-free survival rates were 57.1, 51.4 and 32.1% respectively (Fig. 2
). Median progression-free survival was 41 months (95%, CI 1864). SD was observed in eight patients (38%) after a median follow-up of 49.5 months (IQR 2667). After a median of 18 months (IQR 638.5), tumour progression was seen in 13 out of the 21 patients (62%). In this group of patients, the median follow-up was 21 months (IQR 12.534.5) with seven disease-related deaths, with a median survival of 45 months (95%, CI 21
) and median survival after progression events of 9 months (95%, CI 2.611.4). Neither the location of the tumour nor the type of surgery affected the response to treatment. In particular, among the four patients having palliative resections, two had SD after 74 and 23 months of follow-up, while the other two had disease progression after 4 and 22 months.
|
|
After starting treatment with SMS analogues, complete resolution of abdominal pain was observed in all the eight patients who had complained of this symptom. An increase in body weight was observed in seven out of the ten patients with weight loss; in three patients with rapidly PD, weight loss persisted. Among 13 patients with pathological levels of serum CgA at diagnosis (>98 ng/ml), six had a decrease of more than 50% of the marker during the progression-free survival interval.
Therapeutic side effects
The therapy was well tolerated with no major side effect and no dose modification was required. Among eight patients, whose gallbladder had not been removed, an 84-year old woman experienced a symptomatic lithiasis after 36 months of therapy and was conservatively treated with no need to stop SMS analogue therapy.
Expression of somatostatin receptors 2 and 5
Quantitative RT-PCR demonstrated expression of SSTR2 mRNA in all 12 cases analysed (Table 2
). In particular, there was no significant difference between the expression levels in stable (mean 
Ct±S.D., 4.7±1.6) and PD (mean 
Ct±S.D., 4.9±0.8) compared with normal islets. The expression level of SSTR5 showed a higher variability and no significant difference was seen between patients with SD (mean 
Ct±S.D., 5.3±3.3) compared with those whose tumours progressed (mean 
Ct±S.D., 6.3±1.6). Definite staining was observed in all samples evaluated for SSTR2 expression by immunohistochemistry, confirming that observed with octreoscan scintigraphy. In all cases, the immunostaining of tumour cells was stronger than that observed in normal insulae of Langerhans (Fig. 3
). No significant correlation was observed between the expression of SSTR2 or SSTR5, either at mRNA or protein level, and the response to treatment.
|
|
Tumour progression correlated with a Ki-67 proliferative index
5% at diagnosis (P=0.016; Fig. 4
), absence of abdominal pain (P=0.005) and weight loss (P=0.006). In addition, serum CgA >200 ng/ml at follow-up (HR 5.0 95% CI 1.4617.10; P=0.005) was also associated with tumour progression. No other clinicopathological or laboratory parameter, or the type of surgical procedure showed any significant correlation with treatment outcome.
|
| Discussion |
|---|
|
|
|---|
5% appears to be a reliable marker for identifying the latter group; (iv) additional predictive factors were weight loss and absence of abdominal pain; (v) SMS treatment resulted in clinical benefits in virtually all symptomatic patients; (vi) the expression level of SSTR2 and SSTR5 receptors had no correlation with response to therapy. The common belief that the gastroenteropancreatic neuroendocrine tumours at an advanced stage are still low-grade malignancies, with a long period of stability of disease even without treatment, is not applicable to NF-PEC. In our experience, these patients almost invariably present with symptoms, consisting of abdominal pain, body weight loss or obstruction (jaundice or upper digestive occlusion) (Gullo et al. 2003). This is also true in the present series in which the median tumour size was 60 mm and all patients were symptomatic. Thus, the presence of high tumour burden or metastasis associated with invalidating symptoms is sufficient justification to initiate therapy at the time of diagnosis, avoiding any observation period to wait for radiologically proven progression.
Our prospective phase IV study assessed the efficacy of the SMS analogue octreotide in advanced NF-PEC positive at octreoscan scintigraphy. A significant proportion of our patients (38%) showed long-term SD. Although we did not observe any complete or PR, the 3-year overall survival rate of 74.9% and the median progression-free survival of 41 months can be considered as a good result for patients with advanced NF-PEC. Moreover, this was associated with a high quality of life consisting of a clear clinical benefit with regards, relief of symptoms and treatment tolerability. Such benefits were also seen in the 13 patients who experienced progression.
Although several studies have reported that SMS analogues can achieve stabilization of disease in patients with gastroenteropancreatic neuroendocrine carcinomas, only nine reports included NF-PEC (Table 3
). A total of 68 NF-PEC have been treated with octreotide or lanreotide, but follow-up data are available only for 18 patients (di Bartolomeo et al. 1996, Angeletti et al. 1999, Tomassetti et al. 2000). Among these latter cases, 17 were enrolled with PD and only two cases (11%) experienced disease stabilization (Tomassetti et al. 2000), while the remaining 15 rapidly progressed (Table 3
). The median progression-free survival of 41 months observed in the present trial is, by far, the best reported to date, and cannot be simply explained by the natural history of the disease. A recent study confirmed that the treatment of PEC with SMS analogues initiated after documentation of PD may achieve disease stabilization (5 out of 18 cases, 28%) (Panzuto et al. 2006), while the majority of patients further progressed within 6 months. The higher response rate observed in our study may be due to the early start of treatment in contrast to other studies, and partly to the inclusion of patients with less aggressive diseases as they were enrolled at diagnosis.
|
5% is useful in identifying patients suffering from an aggressive and quickly PD, thus justifying the indication for more aggressive therapeutic regimens. Further support to our finding has also been provided by Aparicio et al.(2001), who reported that a slow tumour growth rate is the only predictive factor for response to therapy with SMS analogues. Additional factors associated with PD were weight loss and lack of abdominal pain at diagnosis. The presence of abdominal pain may be due to the mass effect, thus correlating with a median tumour size in the stable subgroup greater than that in the progressive one (67.5 vs 55 mm, P=0.09).
In conclusion, our study supports the use of SMS analogues as first line therapy at diagnosis in well-differentiated NF-PEC with a low proliferation index, resulting in a substantial rate of SD for up to 5 years associated with a good quality of life. A Ki-67 value
5% and the presence of weight loss may justify more aggressive therapy without waiting for radiologically proven progression of disease.
| Funding |
|---|
| References |
|---|
|
|
|---|
Aparicio T, Ducreux M, Baudin E, Sabourin JC, De Baere T, Mitry E, Schlumberger M & Rougier P 2001 Antitumour activity of somatostatin analogues in progressive metastatic neuroendocrine tumours. European Journal of Cancer 37 10141019.[CrossRef][Web of Science][Medline]
Arnold R, Trautmann ME, Creutzfeldt W, Benning R, Benning M, Neuhaus C, Jurgensen R, Stein K, Schafer H, Bruns C et al. 1996 Somatostatin analogue octreotide and inhibition of tumour growth in metastatic endocrine gastroenteropancreatic tumours. Gut 38 430438.
Cheng PN & Saltz LB 1999 Failure to confirm major objective antitumor activity for streptozocin and doxorubicin in the treatment of patients with advanced islet cell carcinoma. Cancer 86 944948.[CrossRef][Medline]
Delaunoit T, Ducreux M, Boige V, Dromain C, Sabourin JC, Duvillard P, Schlumberger M, de Baere T, Rougier P, Ruffie P et al. 2004 The doxorubicinstreptozotocin combination for the treatment of advanced well-differentiated pancreatic endocrine carcinoma: a judicious option? European Journal of Cancer 40 515520.[CrossRef][Web of Science][Medline]
di Bartolomeo M, Bajetta E, Buzzoni R, Mariani L, Carnaghi C, Somma L, Zilembo N & di Leo A 1996 Clinical efficacy of octreotide in the treatment of metastatic neuroendocrine tumors. A study by the Italian Trials in Medical Oncology Group. Cancer 77 402408.[CrossRef][Web of Science][Medline]
Eriksson B, Renstrup J, Imam H & Oberg K 1997 High-dose treatment with lanreotide of patients with advanced neuroendocrine gastrointestinal tumors: clinical and biological effects. Annals of Oncology 8 10411044.
Gullo L, Migliori M, Falconi M, Pederzoli P, Bettini R, Casadei R, Delle Fave G, Corleto VD, Ceccarelli C, Santini D et al. 2003 Nonfunctioning pancreatic endocrine tumors: a multicenter clinical study. American Journal of Gastroenterology 98 24352439.[CrossRef][Web of Science][Medline]
Kloppel G, Perren A & Heitz PU 2004 The gastroenteropancreatic neuroendocrine cell system and its tumors: the WHO classification. Annals of the New York Academy of Sciences 1014 1327.[CrossRef][Web of Science][Medline]
Kraenzlin ME, Chng JC, Wood SM & Bloom SR 1983 Can inhibition of hormone secretion be associated with endocrine tumour shrinkage? Lancet 2 1501.[Web of Science][Medline]
Miller AB, Hoogstraten B, Staquet M & Winkler A 1981 Reporting results of cancer treatment. Cancer 47 207214.[CrossRef][Web of Science][Medline]
Moertel CG, Hanley JA & Johnson LA 1980 Streptozocin alone compared with streptozocin plus fluorouracil in the treatment of advanced islet-cell carcinoma. New England Journal of Medicine 303 11891194.[Abstract]
Moertel CG, Lavin PT & Hahn RG 1982 Phase II trial of doxorubicin therapy for advanced islet cell carcinoma. Cancer Treatment and Research 66 15671569.
Moertel CG, Lefkopoulo M, Lipsitz S, Hahn RG & Klaassen D 1992 Streptozocindoxorubicin, streptozocinfluorouracil or chlorozotocin in the treatment of advanced islet-cell carcinoma. New England Journal of Medicine 326 519523.[Abstract]
Murray-Lyon IM, Eddleston AL, Williams R, Brown M, Hogbin BM, Bennett A, Edwards JC & Taylor KW 1968 Treatment of multiple-hormone-producing malignant islet-cell tumour with streptozotocin. Lancet 2 895898.[CrossRef][Medline]
Oberg K, Kvols L, Caplin M, Delle Fave G, de Herder W, Rindi G, Ruszniewski P, Woltering EA & Wiedenmann B 2004 Consensus report on the use of somatostatin analogs for the management of neuroendocrine tumors of the gastroenteropancreatic system. Annals of Oncology 15 966973.
Paganelli G, Zoboli S, Cremonesi M, Bodei L, Ferrari M, Grana C, Bartolomei M, Orsi F, De Cicco C, Macke HR et al. 2001 Receptor-mediated radiotherapy with 90Y-DOTA-D-Phe1-Tyr3-octreotide. European Journal of Nuclear Medicine 28 426434.[CrossRef][Web of Science][Medline]
Panzuto F, Di Fonzo M, Iannicelli E, Sciuto R, Maini CL, Capurso G, Milione M, Cattaruzza MS, Falconi M, David V et al. 2006 Long-term clinical outcome of somatostatin analogues for treatment of progressive, metastatic, well-differentiated entero-pancreatic endocrine carcinoma. Annals of Oncology 17 461466.
Papotti M, Bongiovanni M, Volante M, Allia E, Landolfi S, Helboe L, Schindler M, Cole SL & Bussolati G 2002 Expression of somatostatin receptor types 15 in 81 cases of gastrointestinal and pancreatic endocrine tumors. A correlative immunohistochemical and reverse-transcriptase polymerase chain reaction analysis. Virchows Archiv 440 461475.[CrossRef][Web of Science][Medline]
Pelosi G, Bresaola E, Bogina G, Pasini F, Rodella S, Castelli P, Iacono C, Serio G & Zamboni G 1996 Endocrine tumors of the pancreas: Ki-67 immunoreactivity on paraffin sections is an independent predictor for malignancy: a comparative study with proliferating-cell nuclear antigen and progesterone receptor protein immunostaining, mitotic index, and other clinicopathologic variables. Human Pathology 27 11241134.[CrossRef][Web of Science][Medline]
Piemonti L, Leone BE, Nano R, Saccani A, Monti P, Maffi P, Bianchi G, Sica A, Peri G, Melzi R et al. 2002 Human pancreatic islets produce and secrete MCP-1/CCL2: relevance in human islet transplantation. Diabetes 51 5565.
Ramanathan RK, Cnaan A, Hahn RG, Carbone PP & Haller DG 2001 Phase II trial of dacarbazine (DTIC) in advanced pancreatic islet cell carcinoma. Study of the Eastern Cooperative Oncology Group-E6282. Annals of Oncology 12 11391143.
Reubi JC, Kvols L, Krenning E & Lamberts SW 1990 Distribution of somatostatin receptors in normal and tumor tissue. Metabolism 39 7881.[CrossRef][Web of Science][Medline]
Ricci S, Antonuzzo A, Galli L, Orlandini C, Ferdeghini M, Boni G, Roncella M, Mosca F & Conte PF 2000 Long-acting depot lanreotide in the treatment of patients with advanced neuroendocrine tumors. American Journal of Clinical Oncology 23 412415.
Ruszniewski P & Malka D 2000 Hepatic arterial chemoembolization in the management of advanced digestive endocrine tumors. Digestion 62 7983.[CrossRef][Medline]
Saltz L, Trochanowski B, Buckley M, Heffernan B, Niedzwiecki D, Tao Y & Kelsen D 1993 Octreotide as an antineoplastic agent in the treatment of functional and nonfunctional neuroendocrine tumors. Cancer 72 244248.
Tomassetti P, Migliori M & Gullo L 1998 Slow-release lanreotide treatment in endocrine gastrointestinal tumors. American Journal of Gastroenterology 93 14681471.[CrossRef][Web of Science][Medline]
Tomassetti P, Migliori M, Corinaldesi R & Gullo L 2000 Treatment of gastroenteropancreatic neuroendocrine tumours with octreotide LAR. Alimentary Pharmacology & Therapeutics 14 557560.[CrossRef][Web of Science][Medline]
Waldherr C, Pless M, Maecke HR, Schumacher T, Crazzolara A, Nitzsche EU, Haldemann A & Mueller-Brand J 2002 Tumor response and clinical benefit in neuroendocrine tumors after 7.4 GBq (90)Y-DOTATOC. Journal of Nuclear Medicine 43 610616.
This article has been cited by other articles:
![]() |
R. Bettini, L. Boninsegna, W. Mantovani, P. Capelli, C. Bassi, P. Pederzoli, G. F. Delle Fave, F. Panzuto, A. Scarpa, and M. Falconi Prognostic factors at diagnosis and value of WHO classification in a mono-institutional series of 180 non-functioning pancreatic endocrine tumours Ann. Onc., May 1, 2008; 19(5): 903 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Piani, G. M Franchi, C. Cappelletti, M. Scavini, L. Albarello, A. Zerbi, P. Giorgio Arcidiacono, E. Bosi, and M. F Manzoni Cytological Ki-67 in pancreatic endocrine tumours: an opportunity for pre-operative grading Endocr. Relat. Cancer, March 1, 2008; 15(1): 175 - 181. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |