|
|
||||||||
1 Dalton Cardiovascular Research Center, University of Missouri, 134 Research Park Drive, Columbia, Missouri 65211, USA
2 Hamon Center for Therapeutic Oncology Research and Department of Surgery, University of Texas Southwestern Medical Center, Dallas, Texas, USA
3 Biomedical Sciences, University of Missouri, Columbia, Missouri 65211, USA
(Requests for offprints should be addressed to S M Hyder; Email: hyders{at}missouri.edu)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Many human breast cancers contain estrogen receptors and progesterone receptors, which cause proliferation of tumor cells (Spicer & Pike 1994). Steroid hormones have been shown to regulate VEGF in breast cancer cells (Hyder et al. 1998, Hyder & Stancel 1999). This has raised the hypothesis that tumor cells may produce VEGF not only for proliferation of endothelial cells but also for proliferation and/or survival of breast tumor cells in an autocrine and/or paracrine manner. We have recently shown that progestin-induced VEGF secretion from three different breast cancer cell lines can cause tumor cell proliferation in an autocrine and paracrine manner (Liang & Hyder 2005). Other researchers have demonstrated a similar role for VEGF in estrogen-induced tumors (Nakamura et al. 1996, Masood et al. 2001). Hence, VEGF probably affects the progression of breast tumors by impacting on tumor cell proliferation and survival as well as through induction of angiogenesis.
Both anti-estrogens and anti-progestins have been shown to cause regression of hormone-dependent tumors; however, some tumor cells invariably become resistant to the anti-hormones and continue to grow (Gutierrez et al. 2005). In certain cases, anti-hormones can even stimulate tumor growth (Clarke et al. 2001). It is not known what specifically causes the resistant cells to continue to proliferate, although it has been suggested that growth factors may be involved (Nicholson et al. 2005). Interestingly, clinical studies have shown that tumors with high levels of VEGF fail to respond to hormone therapy (Foekens et al. 2001, Manders et al. 2003) suggesting that VEGF production might be involved in anti-hormone resistance.
The objectives of this study were to characterize the growth-inducing properties of VEGF on proliferation and survival in a variety of breast cancer cell lines that are routinely used to study the effects of hormones and anti-hormones on tumor growth. We also sought to identify the signal transduction pathway responsible for VEGF-induced proliferative response, and to determine if the presence of increased levels of VEGF interferes with the growth-suppressive effects of anti-hormones in breast cancer cells.
| Materials and methods |
|---|
|
|
|---|
The breast cancer cell lines T47-D, BT-474, HCC-1428, MCF-7, HCC-1500, MDA-MB-231, and ZR-75, and RPMI-1640 medium were obtained from ATCC (Manassas, VA, USA). All cell lines except HCC-1428 and HCC-1500 express Her-2/neu (Konecny et al. 2003 and data sheet from ATCC) with BT-474, expressing the highest level of HER-2/neu protein. Phenol red-free DME/F12 medium, PBS, and 0.05% trypsinEDTA were purchased from Invitrogen Corporation & Life Technologies and fetal bovine serum (FBS) was obtained from JRH Biosciences (Lenexa, KS, USA). Recombinant human VEGF (rhVEGF165 and rhVEGF121), anti-VEGF antibody (catalog number AF-293-NA, neutralizes both VEGF165 and VEGF121), IgG control antibody, and the VEGF ELISA Kit were obtained from R&D Systems, Inc. (Minneapolis, MN, USA). The antibody 2C3 that blocks interaction of VEGF from binding to VEGFR2 (flk) was raised against recombinant human VEGF as described previously (Brekken et al. 2000). C44, an IgG2a mouse anti-colchicine monoclonal antibody (Rouan et al. 1990) served as a negative control and was from ATCC. The antibody against VEGFR2 (flk/kdr) was from Santa Cruz, CA (catalog number SC-6251). The inhibitor for VEGFR2 Tyr kinase activity (SU1498), the phosphoinositide 3-kinase (PI3K) inhibitor LY294002, and the MAPK/ERK inhibitor U0126 were obtained from CalBiochem (La Jolla, CA, USA). The ELISA kit to detect BrdU (bromodeoxyuridine) incorporation in cells was from Roche Diagnostics Corporation and progesterone (P), medroxyprogesterone acetate (MPA), and sulforhodamine B (SRB) were obtained from Sigma. All the primers used in the study were synthesized at Integrated Device Technology(IDT) (Coralville, IA, USA). The anti-Bcl2, anti-flk/kdr, and secondary horseradish peroxidase-conjugated antibodies were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Protein was quantified using the Bicinchoninic acid (BCA) assay (PIERCE, Rockford, IL, USA) and absorbance was measured at 562 nm with a SpecTRA MAX 190 Microplate Reader (Molecular Device, Sunnyvale, CA, USA).
Cell culture
T47-D, BT-474, MCF-7, ZR-75, and MDA-MB-231 cells were grown in phenol red-free DME/F12 medium supplemented with 10% FBS (T47-D, BT-474, MCF-7, and ZR-75) or 5% FBS (MDA-MB-231). HCC-1428 and HCC-1500 were grown in RPMI-1640 medium supplemented with 10% FBS, 10 mM HEPES, 1 mM sodium pyruvate, 2 mM L-Gln, 4500 mg glucose/l, and 1500 mg sodium bicarbonate/l. All cells were grown in 100x20 mm2 tissue culture dishes and harvested with 0.05% trypsinEDTA.
RT-PCR for VEGF receptor flk/kdr and flt-1
Cells were grown in DME/F12 medium supplemented with 5% dextran-coated, charcoal-treated serum for 24 h. RNA was prepared using UltraSpec (Biotecx, Houston, TX, USA) according to the manufacturers protocol. Reverse transcription (RT)-PCR was carried out using Platinum PCR Supermix (Invitrogen) in an Applied Biosystems 2700 thermocycler. PCR parameters were as follows: 94 °C for 5 min, 35 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, followed by 72 °C for 7 min. MDA-MB-231 cDNA was used as a VEGFR2-positive control. The PCR product was analyzed on a 2% agarose gel containing 1 µg/ml ethidium bromide. Electrophoresis was carried out in 0.5X TBE (pH 8.0) at 80 V for 2 h. The gel was photographed under UV light. Primer sequences were as follows: VEGFR2 (flk/kdr) (400 bp product), sense: CATCACATCCACTGGTATTGG, antisense: GCCA-AGCTTGTACCATGTGAG; VEGFR1 (flt) (300 bp product), sense: TACACAGGGGAAGAAATCCT, and antisense: ACAGAGCCCTTCTGGTTGGT. Primers for the internal 18S control were obtained from an Ambion kit (Austin, TX, USA).
Cell proliferation assay by BrdU incorporation, ELISA
Cells were seeded into each well of a 96-well plate and incubated overnight at 37 °C with 5% CO2. Twenty four hours prior to the experiment, the medium was replaced with serum-free DME/F12. The cells were then incubated under various conditions (VEGF, anti-VEGF antibody, progesterone, MPA, or SU1498) for 24 h. BrdU (100 µM) was added to each well, 3 h before termination of the treatment as described before (Liang & Hyder 2005) and the measurement was completed using the manufacturers protocol. Absorbance was read at 370 nm with a SpecTRA MAX 190 Microplate Reader. Each experimental point was assayed in six different wells, and each study was carried out in duplicate or triplicate.
Cell proliferation assay by SRB
The SRB assay was used to measure cell viability as previously described (Rubenstein et al. 1990, Skehan et al. 1990). This cell protein dye-binding assay measures the protein content in surviving cells as an index to determine cell growth and viability (Rubenstein et al. 1990, Skehan et al. 1990). Briefly, 5 x 103 T47D cells or 8 x 103 BT-474 cells were seeded in each well of 96-well plates in 100 µl culture medium (DME/F12 + 10% FBS) and incubated overnight at 37 °C with 5% CO2. The next day, the medium was switched to serum-free DME/F12 medium and incubated for 1824 h. The medium was then replaced and various concentrations of VEGF, anti-VEGF antibody, 10 nM progesterone, or MPA were added for 72 h. VEGF was replaced after 48 h of incubation. Surviving or adherent cells were fixed in situ by withdrawing the growth medium and adding 100 µl of PBS and 100 µl of 50% cold trichloroacetic acid and then incubated at 4 °C for 1 h. Cells were washed in ice water and then dried. Cells were then stained in 50 µl of 4% SRB for 8 min at room temperature. Unbound dye was removed by washing five times with cold 1% acetic acid and cells were dried at room temperature. Bound stain was solubilized with 150 µl 10 mM Tris. The absorbance of samples was measured at 520 nm with a SpecTRA MAX 190 microplate reader. Six wells were used for each concentration and each experiment was performed at least twice.
Cell apoptosis and death assay
Annexin V-FITC apoptosis detection kit (Biovision Research Products, Mountain View, CA, USA) was used for detecting early stages of apoptosis. Propidium iodide was used for detection of DNA fragmentation or cell death. Cells were grown in six well plates and treated with VEGF, VEGF with or without anti-VEGF antibody, 2C3, and SU1498 for 48 h. The percentage of Annexin V-FITC positive and PI-positive cells were determined from the fluorescence of 10 000 cells by a FACScan flow cytometer (Becton Dickinson, San Jose, CA, USA). The experiments were performed twice.
Whole cell extracts and Western blots
Breast cancer cells were grown and treated with various reagents in 100 mm dishes. At the end of incubation, cells were washed with 3 ml of ice-cold PBS and harvested by gentle scraping. Cells were centrifuged for 5 min at 200 x g at 4 °C and the pellet was re-suspended in either 200 µl radioimmuno precipitation assay (RIPA) buffer for flk/kdr detection (1 mM dithiothreitol (DTT; Sigma) and 1% protease inhibitor cocktail was added prior to use) or in 100 µl complete lysis buffer with protease inhibitor (Active Motif) for Bcl-2 detection by Western blot. The mixture was then incubated on ice for 30 min with shaking. Samples were centrifuged at 14 000 x g for 15 min, and the supernatant was transferred to microcentrifuge tube, aliquoted, and stored at 80 °C. The supernatant was adjusted to the desired protein concentration as needed.
For western blotting, samples containing 3050 µg of protein were separated by SDS-PAGE in NuPAGE 38% TrisAcetate Gel (Invitrogen) for flk/kdr detection and in NuPAGE 10% Bis-Tris Gel for Bcl2. Electrophoresis was performed at 100 V for 2 h using NuPAGE TrisAcetate SDS or 2-(N-Morpholino)ethane-sulfonic (MES) SDS running buffer. Separated proteins were transferred to polyvinylidene difluoride membranes (Bio-Rad) at 30 V for 1.5 h. The blots were blocked for 1 h at room temperature (RT) in 5% non-fat dry milk in Tris buffered saline (TBS) containing 0.1% Tween 20 (TBS-T), and incubated with primary anti-flk/kdr antibody (1:400 dilution) or anti-BcL-2 antibody (1:200) for 2 h at RT. The blots were washed three times with TBS-T and incubated with secondary antibody for 1 h at RT. The blots were then washed six times (8 min each) with TBS-T and immunoreactive bands were visualized using an ECL plus detection kit (Amersham, Pharmacia Biotech). Membranes were stripped and re-blotted for ß-actin (Sigma), which was used as a control for protein loading.
Statistical analysis
Differences among groups were tested using one-way ANOVA with repeated measure over time. The assumption of ANOVA was examined and non-parametric measure based on ranks was used if needed. Values were reported as mean ± S.E.M. When ANOVA indicated significant effect (F-ratio, P < 0.05), the StudentKeuls multirange test was employed to compare the mean of the individual groups using SigmaStat software (Systat Software Inc., Richmond, CA, USA).
| Results |
|---|
|
|
|---|
We initially tested the effect of VEGF165 on the proliferation of BT-474 and T47-D cells in serum-free conditions. As shown in Fig. 1A
, VEGF increased BrdU incorporation in both cell lines. This process was inhibited significantly by an anti-VEGF antibody, but not by non-specific immunoglobulin (IgG). Neither antibody nor IgG alone had any effect on cellular proliferation. VEGF also increased cell viability as determined by the SRB assay, which detects cellular protein (Fig. 1B
; Rubenstein et al. 1990, Skehan et al. 1990). This increase in cell viability was also inhibited by an anti-VEGF antibody. Interestingly, the addition of an antibody that specifically sequestered the exogenous VEGF consistently showed that T47-D cells were more strongly dependent on VEGF than the BT-474 cells, since sequestration of VEGF led to a loss of viability in T47-D cells. However, the VEGF antibody alone did not reduce cell viability, suggesting that factors other than VEGF produced by tumor cells must be involved in cell viability. The loss of cell viability when VEGF and VEGF antibody were present at the same time suggests that this complex must also sequester some other factors that are required for the viability of T47-D cells, as we also reported in our earlier communication (Liang & Hyder 2005). No such effect was observed in BT-474 cells. The serum-free conditions used in these experiments were optimal for observing VEGF-induced proliferation of breast cancer cells, since our preliminary studies showed that addition of either steroid deprived media containing 5% dextran-coated charcoal treated serum or addition of growth factor supplements into serum-free medium inhibited VEGF-induced proliferation of tumor cells (data not shown).
|
To test whether the VEGF-dependent proliferation of breast cancer cells was dependent on the presence of VEGF receptors, we used RT-PCR to amplify VEGFR2 (flk/kdr) or VEGFR1 (flt) in seven different human tumor cell lines commonly used in breast cancer research. As shown in Fig. 2A
, four of the seven breast cancer cell lines expressed both VEGFR2 (flk/kdr) and VEGFR1 (flt), and one expressed only VEGFR2 (MDA-MB-231). The VEGF receptor-positive tumor cell lines included BT-474, T47D, HCC-1428, and MCF-7, which express the ER and PR, as well as MDA-MB-231 cells, which lack the ER and PR. Cell lines that lacked expression of either VEGF receptor included HCC-1500 and ZR-75 cells (Fig. 2A
). Western blot analysis indicated that tumor cells that lacked VEGF RNA expression also lacked the VEGFR2 protein (Fig. 2B
). We next tested these cell lines for VEGF-induced proliferation. As shown in Fig. 2C
, only the VEGF receptor-positive cells dose dependently proliferated in response to VEGF. The VEGF receptor-negative HCC-1500 and ZR-75 cell lines did not exhibit a proliferative response to VEGF (Fig. 2B
). The effects of VEGF were variable across the VEGFR2-positive cells lines, whereas T47-D and BT-474 cells continued to respond to VEGF with increasing concentrations of the growth factor (1200 ng/ml), HCC-1428 and MCF-7 cells exhibited a maximal response at about 50 ng/ml, and MDA-MB-231 cells reached the maximum response at about 100 ng/ml (Fig. 2B
). In this limited series of tumor cells, there did not appear to be any correlation between the expression levels of VEGF receptors as determined by RT-PCR analysis, the amount of protein detected and the degree of VEGF-induced cellular proliferation.
|
In addition to the antibody study described above, we used SU1498, an inhibitor of the tyrosine kinase activity of VEGFR2, to determine whether VEGFR2 is also responsible for VEGF-mediated proliferation in T47-D and BT-474 cells. As shown in Fig. 2E
, SU1498 blocked VEGF-stimulated BrdU incorporation in both tumor cell lines in a dose-dependent manner, indicating that VEGF-mediated proliferation of these breast tumor cells was dependent on VEGFR2. Interestingly, following SU1498 treatment, BrdU incorporation reached values below those of control cells. This might be explained by additional interactions of SU1498 at higher concentrations with platelet derived growth factor (PDGF) receptor, epidermal growth factor (EGF)-receptor and HER-2 kinases (Calbiochem data sheet).
Influence of VEGF isoforms on proliferation of tumor cells
Other studies have clearly established that the two secreted forms of VEGF, VEGF165 and VEGF121, induce proliferation of endothelial cells (Soker et al. 1997). We tested the two isoforms separately to determine their effects on the proliferation of BT-474 and T47-D cells. As shown in Fig. 3
, both isoforms stimulated the proliferation of breast tumor cells. However, VEGF165 appeared to be more potent as previously reported for endothelial cells (Graells et al. 2004). Quantitatively, both cell lines responded similarly to increasing concentrations of VEGF165 and VEGF121, though with 200 ng/ml, VEGF165 BT-474 cells responded significantly better than T47-D cells (as also observed in Fig. 2C
). These results demonstrate that both VEGF isoforms induce breast cancer cell proliferation, though high concentrations of VEGF165 elicit an increased response in BT-474 cells.
|
As shown in Fig. 2D
, VEGF-dependent proliferation of breast cancer cells was dependent on VEGFR2. Other investigators have shown that the interaction of VEGF with VEGFR2 can activate the PI3-kinase/Akt-dependent signaling pathway and the mitogen activated protein kinase/extracellular signal-regulated kinase (MAPK/ERK) signal transduction pathway (Graells et al. 2004, Svensson et al. 2005). We used specific inhibitors of four different signaling modules to identify the pathway involved in mediating VEGF-induced tumor cell proliferation in BT-474 and T47-D breast cancer cells. The inhibitors tested included LY294002 (a PI3K inhibitor), U0126 (a MAPK/ERK inhibitor), SB202190 (a MAPK/p38 inhibitor) and SP600125 (a MAPK/c-jun inhibitor). Cells were incubated with increasing concentrations of inhibitor in the presence or absence of 100 ng/ml VEGF. The results demonstrated that the MAPK/ERK inhibitor, U0126 blocked proliferation of both T47-D and BT-474 cells (Fig. 4A and B
). A similar level of inhibition was also observed with the MAPK/p38 pathway inhibitor SB202190 (data not shown). However, inhibitors for the PI3-kinase dependent signal transduction pathway (Fig. 4A and B
) and MAPK/c-jun pathway (data not shown) were without effect.
|
Since VEGF can induce proliferation of breast cancer cells, it was expected that VEGF would induce expression of the anti-apoptotic protein Bcl-2. We tested this hypothesis in BT-474, T47-D, and MCF-7 cells by incubating the cells overnight with VEGF (50 or 100 ng/ml) in the presence or absence of an anti-VEGF antibody. As shown in Fig. 5A
, VEGF at both 50 and 100 ng/ml increased Bcl-2 levels in the three cell lines tested and in all cases the induction was blocked by the anti-VEGF antibody. For reasons that remain unclear, incubating cells with VEGF plus the anti-VEGF antibody reduced Bcl-2 expression levels below basal levels in both T47-D and MCF-7 cells. This was similar to the results shown in Fig. 1B
, in which VEGF led to loss of cell viability in the presence of the anti-VEGF antibody, as compared with the anti-VEGF antibody alone.
|
VEGF inhibits the anti-proliferative effects of anti-hormones in ER-and PR-containing breast cancer cell lines
Bcl-2 is an anti-apoptotic protein that functions in cell survival, tumor progression, and drug resistance, and is induced in response to VEGF in breast cancer cells. Consequently, we wondered whether the pro-proliferative hormone estrogen might also induce Bcl-2 in estrogen-responsive MCF-7 cells. Fig. 6A
shows that estradiol increased Bcl-2 expression in the MCF-7 cell line, an induction which was blocked by the anti-estrogen ICI 182,780, which is known to be anti-proliferative and pro-apoptotic for these cells (Ellis et al. 1997). In contrast, the ICI 182,780-mediated down-regulation of Bcl-2 was blocked in the presence of VEGF (Fig. 6A
).
|
We also tested the effects of RU-486 on Bcl-2 expression in T47-D and BT-474 cells, both of which proliferate in response to progesterone. RU-486 is an anti-progestin that suppresses cellular proliferation. As shown in Fig. 7A
, progesterone and RU-486 did not induce Bcl-2 expression in either BT-474 or T47-D cells. However, VEGF induced the expression of Bcl-2 even in the presence of RU-486, which prevents cellular proliferation. When we tested the effects of VEGF on the anti-proliferative actions of RU-486 in the two cell lines, we found that it promoted the proliferation of both BT-474 and T47-D cells in a dose-dependent manner, even in the presence of progesterone and 100-fold excess RU-486 (Fig. 7B
).
|
| Discussion |
|---|
|
|
|---|
The present investigation was undertaken to determine whether VEGF is a proliferative and/or a survival factor in various breast cancer cell lines that are frequently used to investigate the effects of steroid hormones on cellular proliferation. Furthermore, we wished to determine if the presence of excess VEGF overrides the anti-proliferative effects of anti-hormones that are known to mediate apoptosis of breast cancer cells and thus control proliferation of breast tumors (Ellis et al. 1997). Our results demonstrate that VEGF dose dependently drives proliferation of various breast cancer cells and that this effect is dependent on the presence of VEGFR2 (flk). Interestingly, the large panel of breast cancer cells utilized indicated that although all cells that expressed VEGFR2 responded to VEGF with proliferation, there were differences in sensitivity in the various cell lines. This could be due to the presence of different levels of VEGF receptors on the cell surface or due to interactions of receptors with other proteins and receptors, e.g., neuropilin receptors (Barr et al. 2005) that could affect the sensitivity of tumor cells to VEGF-induced proliferation. Our findings also show that VEGF likely protects the cells from undergoing apoptosis in serum-deprived conditions by up-regulating the expression of Bcl-2.
There is considerable interest in inhibiting tumor cell growth by reducing VEGF levels and thereby inhibiting endothelial cell growth and/or promoting apoptosis of tumor cells. Therefore, we examined a large panel of breast cancer cells utilized in hormone-related cancer research to observe the extent to which VEGF serves as a proliferative growth factor. We concentrated mainly on ER- and PR-positive cells, since the majority of breast cancer patients whose tumors express PR and ER are treated with anti-hormones, and the tumors subsequently become resistant to endocrine therapy, while retaining their receptor status (Ali & Coombes 2000). Recent reports have hinted that excess VEGF production could contribute to the acquisition of anti-hormone resistance (Ryden et al. 2005). Leptin has also been shown to exert similar effects and to override the effects of ICI 182,780 in breast cancer cells (Garofalo et al. 2004). Thus, one mechanism that drives the resistance of tumors to anti-hormones may include excess production of growth-promoting factors from tumor cells.
Previous studies have shown that VEGF can induce proliferation of breast cancer cells (Liang & Hyder 2005). However, other studies failed to observe this effect (Price et al. 2001). Our own studies indicate that cell culture conditions can have a profound effect on VEGF-induced proliferation; we found that serum inhibited the proliferative response (data not shown). Under serum-free conditions, however, VEGF induced proliferation in five out of the seven breast cancer cell lines tested. The common feature amongst the VEGF-responsive cells was the presence of VEGFR2, which has previously been shown to mediate the proliferative response in other cell types (Ferrara et al. 2003). A recent study has implicated VEGFR1 in breast tumor cell growth and survival also (Wu et al. 2006a). Thus, further studies are needed to clarify the role of VEGFR1 and VEGFR2 in the proliferation and survival of breast cancer cells. Nevertheless, future therapeutic strategies will most likely involve strategies to block both receptors for significant inhibition of VEGF-dependent breast cancer growth and proliferation in vivo.
Our data suggest that one mechanism for VEGF-induced survival and progression of breast cancer cells could be the expression of the anti-apoptotic protein Bcl-2 (Fig. 5
7A![]()
). Bcl-2 has previously been shown to be increased in response to VEGF in MDA-MB-231 cells (Pidgeon et al. 2001) and has recently been implicated in angiogenesis and expansion of tumors (Karl et al. 2005), although its role in breast cancer cells is not clear. Our data show that VEGF-induced Bcl-2 expression is a general phenomenon in breast cancer cells that may have a broader role than simply serving as an anti-apoptotic protein. Interestingly, Bcl-2 was also induced by estradiol in MCF-7 cells; an estrogen response element that has previously been mapped in this gene (Perillo et al. 2000). ICI 182,780 blocked E2-induced Bcl-2 expression, indicating that part of the anti-proliferative response of ICI 182,780 could be due to decreasing the expression of this survival protein. When MCF-7 cells were exposed to VEGF and ICI 182,780 simultaneously, the loss of Bcl-2 was blocked and proliferation was increased (Fig. 6A and B
). Since ICI 182,780 has been shown to down-regulate ER (Wu et al. 2006b), it is possible that Bcl-2 induction seen with E2, ICI 182,780, and exogenous VEGF is ER independent and is mediated by the exogenous VEGF alone. Since ER has been reported to induce VEGF in MCF-7 breast cancer cells by some investigators (Hyder 2006), it is possible that such an induction of VEGF is directly responsible for Bcl2 induction and cell survival. Similar results were observed for counteracting the anti-proliferative effects of RU-486 in breast cancer cells (Fig. 7
). Taken together, these findings suggest that an increased production of VEGF by tumor cells could contribute to anti-hormone resistance in tumor cells and may also protect them from apoptosis by increasing Bcl-2 levels.
In summary, the findings from this study suggest that VEGF can induce proliferation and survival of breast cancer cells that express VEGFR2 (flk). This contrasts with the view that VEGF is primarily an endothelial cell-specific mitogen. The proliferative response is dependent on the MAPK/ERK signaling pathway. The VEGF-dependent proliferative response overrides the anti-proliferative effects of anti-hormones in breast cancer cells. This might result from the direct effects of VEGF via its receptors and also from VEGF-dependent induction of anti-apoptotic Bcl-2 protein, which has recently been shown to induce angiogenesis (Karl et al. 2005). These observations support the view that combined treatment modalities, including anti-hormones and anti-angiogenic compounds, should be considered for treating ER- and PR-positive breast cancers, especially those that express high levels of VEGF. The concept of trimodal cancer therapy has recently been proposed (Huber et al. 2005). It would seem beneficial to consider trimodal therapy in breast cancer, targeting not only VEGF production, but also VEGF receptors and the MAPK/ERK signaling pathway. Such modalities may not only overcome anti-hormone resistance but may also block proliferation of tumors lacking steroid receptors but expressing VEGF receptors and an active MAPK/ERK pathway that may mediate VEGF-dependent proliferation of tumor cells.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Barr MP, Byrne AM, Duffy AM, Condron CM, Devocelle M, Harriott P, Bouchier-Hayes DJ & Harmey JH 2005 A peptide corresponding to the neuropilin-1-binding site on VEGF(165) induces apoptosis of neuropilin-1-expressing breast tumour cells. British Journal of Cancer 92 328333.[Web of Science][Medline]
Bergers G & Benjamin LE 2003 Tumorigenesis and the angiogenic switch. Nature Reviews Cancer 3 401410.[CrossRef][Web of Science][Medline]
Borgstrom P, Gold DP, Hillan KJ & Ferrara N 1999 Importance of VEGF for breast cancer angiogenesis in vivo: implications from intravital microscopy of combination treatments with an anti-VEGF neutralizing monoclonal antibody and doxorubicin. Anticancer Research 19 42034214.[Web of Science][Medline]
Brekken RA, Overholser JP, Stastny VA, Waltenberger JA, Minna JD & Thorpe PE 2000 Selective inhibition of vascular endothelial growth factor (VEGF) receptor 2 (kd/flk-1) activity by a monoclonal anti-VEGF antibody blocks tumor growth in mice. Cancer Research 60 51175124.
Brown LF, Yeo KT, Berse B, Morgentaler A, Dvorak HF & Rosen S 1995 Vascular permeability factor (vascular endothelial growth factor) is strongly expressed in the normal male genital tract and is present in substantial quantities in semen. Journal of Urology 154 576579.[CrossRef][Web of Science][Medline]
Clarke R, Leonessa F, Welch JN & Skaar TC 2001 Cellular and molecular pharmacology of antiestrogen action and resistance. Pharmacological Reviews 53 2571.
Ellis PA, Saccani-Jotti G, Clarke R, Johnston SR, Anderson E, Howell A, AHern R, Salter J, Detre S, Nicholson R et al. 1997 Induction of apoptosis by tamoxifen and ICI 182780 in primary breast cancer. International Journal of Cancer 72 608613.[CrossRef][Web of Science][Medline]
Ferrara N 2002 Role of vascular endothelial growth factor in physiologic and pathologic angiogenesis: therapeutic implications. Seminars in Oncology 29 1014.[Web of Science][Medline]
Ferrara N, Gerber HP & LeCouter J 2003 The biology of VEGF and its receptors. Nature Medicine 9 669676.[CrossRef][Web of Science][Medline]
Foekens JA, Peters HA, Grebenchtchikov N, Look MP, Meijer-van Gelder ME, Geurts-Moespot A, van der Kwast TH, Sweep CG & Klijn JG 2001 High tumor levels of vascular endothelial growth factor predict poor response to systemic therapy in advanced breast cancer. Cancer Research 61 54075014.
Folkman J 1995 Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature Medicine 1 2731.[CrossRef][Web of Science][Medline]
Garofalo C, Sisci D & Surmacz E 2004 Leptin interferes with the effects of the antiestrogen ICI 182,780 in MCF-7 breast cancer cells. Clinical Cancer Research 10 64666475.
Gasparini G, Toi M, Gion M, Verderio P, Dittadi R, Hanatani M, Matsubara I, Vinante O, Bonoldi E, Boracchi P et al. 1997 Prognostic significance of vascular endothelial growth factor protein in node-negative breast carcinoma. Journal of the National Cancer Institute 89 3947.
Graells J, Vinyals A, Figueras A, Llorens A, Moreno A, Marcoval J, Gonzalez FJ & Fabra A 2004 Overproduction of VEGF concomitantly expressed with its receptors promotes growth and survival of melanoma cells through MAPK and PI3K signaling. Journal of Investigative Dermatology 123 11511161.[CrossRef][Web of Science][Medline]
Gutierrez MC, Detre S, Johnston S, Mohsin SK, Shou J, Allred DC, Schiff R, Osborne CK & Dowsett M 2005 Molecular changes in tamoxifen-resistant breast cancer: relationship between estrogen receptor, HER-2, and p38 mitogen- activated protein kinase. Journal of Clinical Oncology 23 24692476.
Huber PE, Bischof M, Jenne J, Heiland S, Peschke P, Saffrich R, Grone HJ, Debus J, Lipson KE & Abdollahi A 2005 Trimodal cancer treatment: beneficial effects of combined antiangiogenesis, radiation, and chemotherapy. Cancer Research 65 36433655.
Hyder SM 2006 Sex-steroid regulation of vascular endothelial growth factor in breast cancer. Endocrine Related Cancer (In Press).
Hyder SM & Stancel GM 1999 Regulation of angiogenic growth factors in the female reproductive tract by estrogens and progestins. Molecular Endocrinology 13 806811.
Hyder SM & Stancel GM 2000 Regulation of VEGF in the reproductive tract by sex- steroid hormones. Histology and Histopathology 15 325334.[Web of Science][Medline]
Hyder SM, Murthy L & Stancel GM 1998 Progestin regulation of vascular endothelial growth factor in human breast cancer cells. Cancer Research 58 392395.
Karl E, Warner K, Zeitlin B, Kaneko T, Wurtzel L, Jin T, Chang J, Wang S, Wang CY, Strieter RM et al. 2005 Bcl-2 acts in a proangiogenic signaling pathway through nuclear factor-kappa B and CXC chemokines. Cancer Research 65 50635069.
Konecny G, Pauletti G, Pegram M, Untch M, Dandekar S, Aguilar Z, Wilson C, Rong HM, Bauerfeind I, Felber M et al. 2003 Quantitative association between HER-2/neu and steroid hormone receptors in hormone receptor-positive primary breast cancer. Journal of the National Cancer Institute 95 142153.
Kuroda M, Oka T, Oka Y, Yamochi T, Ohtsubo K, Mori S, Watanabe T, Machinami R & Ohnishi S 1995 Colocalization of vascular endothelial growth factor (vascular permeability factor) and insulin in pancreatic islet cells. Journal of Clinical Endocrinology and Metabolism 80 31963200.[Abstract]
Liang Y & Hyder SM 2005 Proliferation of endothelial and tumor epithelial cells by progestin-induced VEGF from human breast cancer cells: paracrine and autocrine effects. Endocrinology 146 36323641.
Manders P, Beex LV, Tjan-Heijnen VC, Span PN & Sweep CG 2003 Vascular endothelial growth factor is associated with the efficacy of endocrine therapy in patients with advanced breast carcinoma. Cancer 98 21252132.
Masood R, Cai J, Zheng T, Smith DL, Hinton DR & Gill PS 2001 Vascular endothelial growth factor (VEGF) is an autocrine growth factor for VEGF receptor-positive human tumors. Blood 98 19041913.
Mercurio AM, Bachelder RE, Bates RC & Chung J 2004 Autocrine signaling in carcinoma: VEGF and the alpha6beta4 integrin. Seminars in Cancer Biology 14 115122.[CrossRef][Web of Science][Medline]
Nakamura J, Savinov A, Lu Q & Brodie A 1996 Estrogen regulates vascular endothelial growth/permeability factor expression in 7,12- dimethylbenz(a) anthracene-induced rat mammary tumors. Endocrinology 137 55895596.[Abstract]
Nicholson RI, Hutcheson IR, Hiscox SE, Knowlden JM, Giles M, Barrow D & Gee JMW 2005 Growth factor signaling and resistance to selective oestrogen receptor modulators and pure anti-oestrogens: the use of anti-growth factor therapies to treat or delay endocrine resistance in breast cancer. Endocrine-Related Cancer 12 S29S36.
Obermair A, Kucera E, Mayerhofer K, Speiser P, Seifert M, Czerwenka K, Kaider A, Leodolter S, Kainz C & Zeillinger R 1997 Vascular endothelial growth factor (VEGF) in human breast cancer: correlation with disease-free survival. International Journal of Cancer 74 455458.[CrossRef][Web of Science][Medline]
Perillo B, Sasso A, Abbondanza C & Palumbo G 2000 17beta-estradiol inhibits apoptosis in MCF-7 cells, inducing bcl-2 expression via two estrogen-responsive elements present in the coding sequence. Molecular and Cellular Biology 20 28902901.
Pidgeon GP, Barr MP, Harmey JH, Foley DA & Bouchier-Hayes DJ 2001 Vascular endothelial growth factor (VEGF) upregulates BCL-2 and inhibits apoptosis in human and murine mammary adenocarcinoma cells. British Journal of Cancer 85 273278.[CrossRef][Web of Science][Medline]
Price DJ, Miralem T, Jiang S, Steinberg R & Avraham H 2001 Role of vascular endothelial growth factor in the stimulation of cellular invasion and signaling of breast cancer cells. Cell Growth and Differentitation 12 129135.
Rouan SK, Otterness IG & Cunningham AC 1990 Reversal of colchicines-induced mitotic arrest in Chinese hamster cells with a colchicines-specific monoclonal antibody. American Journal of Pathology 137 779787.[Abstract]
Rubenstein LV, Shoemaker RH, Paul KD, Simon RM, Skehan P, Scudiero DA, Monks A & Boyd MR 1990 Comparison of in vitro anticancerdrug-screening data generated with a tetrazolium assay versus a protein assay against a diverse panel of human tumor cell lines. Journal of the National Cancer Institute 82 11131118.
Ryden L, Stendahl M, Jonsson H, Emdin S, Bengtsson NO & Landberg G 2005 Tumor-specific VEGF-A and VEGFR2 in postmenopausal breast cancer patients with long-term follow-up. Implication of a link between VEGF pathway and tamoxifen response. Breast Cancer Research and Treatment 89 135143.[CrossRef][Web of Science][Medline]
Schoeffner DJ, Matheny SL, Akahane T, Factor V, Berry A, Merlino G & Thorgeirsson UP 2005 VEGF contributes to mammary tumor growth in transgenic mice through paracrine and autocrine mechanisms. Laboratory Investigation 85 608623.[CrossRef][Web of Science][Medline]
Skehan P, Storeng R, Scudiero D, Monks A, McMahon J, Vistica D, Warren JT, Bokesch H, Kenney S & Boyd MR 1990 New colorimetric cytotoxicity assay for anti-cancer-drug screening. Journal of the National Cancer Institute 82 11071112.
Soker S, Gollamudi-Payne S, Fidder H, Charmahelli H & Klagsbrun M 1997 Inhibition of vascular endothelial growth factor (VEGF)-induced endothelial cell proliferation by a peptide corresponding to the exon 7-encoded domain of VEGF165. Journal of Biological Chemistry 272 3158231588.
Spicer DV & Pike MC 1994 Sex steroids and breast cancer prevention. Journal of the National Cancer Institute. Monographs 139147.
Svensson S, Jirstrom K, Ryden L, Roos G, Emdin S, Ostrowski MC & Landberg G 2005 ERK phosphorylation is linked to VEGFR2 expression and Ets- Phosphorylation in breast cancer and is associated with tamoxifen treatment resistance and small tumours with good prognosis. Oncogene 24 43704379.[CrossRef][Web of Science][Medline]
Wu Y, Hooper AT, Zhong Z, Witte L, Bohlen P, Rafii S & Hicklin DJ 2006a The vascular endothelial growth factor receptor (VEGFR-1) supports growth and survival of human breast carcinoma. International Journal of Cancer (In Press).
Wu J, Liang Y, Nawaz Z & Hyder SM 2006b Complex agonist-like properties of ICI 182,780 (Faslodex) in human breast cancer cells that predominantly express progesterone receptor-B: implications for treatment resistance. International Journal of Oncology 27 16471659.
This article has been cited by other articles:
![]() |
S. M Hyder, Y. Liang, J. Wu, and V. Welbern Regulation of thrombospondin-1 by natural and synthetic progestins in human breast cancer cells Endocr. Relat. Cancer, September 1, 2009; 16(3): 809 - 817. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Roland, S. P. Dineen, K. D. Lynn, L. A. Sullivan, M. T. Dellinger, L. Sadegh, J. P. Sullivan, D. S. Shames, and R. A. Brekken Inhibition of vascular endothelial growth factor reduces angiogenesis and modulates immune cell infiltration of orthotopic breast cancer xenografts Mol. Cancer Ther., July 1, 2009; 8(7): 1761 - 1771. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Dellapasqua, F. Bertolini, V. Bagnardi, E. Campagnoli, E. Scarano, R. Torrisi, Y. Shaked, P. Mancuso, A. Goldhirsch, A. Rocca, et al. Metronomic Cyclophosphamide and Capecitabine Combined With Bevacizumab in Advanced Breast Cancer J. Clin. Oncol., October 20, 2008; 26(30): 4899 - 4905. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Al-Dissi, D. M. Haines, B. Singh, and B. A. Kidney Immunohistochemical Expression of Vascular Endothelial Growth Factor and Vascular Endothelial Growth Factor Receptor Associated with Tumor Cell Proliferation in Canine Cutaneous Squamous Cell Carcinomas and Trichoepitheliomas Veterinary Pathology, November 1, 2007; 44(6): 823 - 830. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |