|
|
||||||||
1 Institute of Endocrine Sciences, University of Milan and Fondazione Policlinico IRCCS, Milan, Italy
2 Internal Medicine Department and
3 Endocrine Surgery Regional Referral Centre, University of Perugia, Perugia, Italy
4 Department of Endocrinology and Metabolism, University of Pisa, Pisa, Italy
5 Department of Pathology, University of Perugia, Perugia, Italy
6 Department of Oncology, University of Pisa, Pisa, Italy
7 Pathology Unit, University of Milan, Ospedale San Paolo and Fondazione Policlinico IRCSS, Milan, Italy
8 Departments of Internal Medicine, Endocrinology and Metabolism, and Biochemistry, University of Siena, Siena, Italy
(Requests for offprints should be addressed to L Fugazzola; E mail: l.fugazzola{at}policlinico.mi.it)
| Abstract |
|---|
|
|
|---|
2/Fishers exact test and t-test. Overall, a heterozygous T > A transversion at nucleotide 1799 (V600E) was found in 99 out of 260 PTCs (38%). According to the histological type of the tumor, the B-RAF V600E mutation was present in 48.3% of cases of classic PTCs (85 out of 176), in 17.6% (nine out of 51) of follicular variants of PTCs, in 21.7% (five out of 23) in other PTC variants and in none of the ten poorly differentiated tumors. B-RAF V600E was significantly associated with the classic variant of PTC (P = 0.0001) and with an older age at diagnosis (P = 0.01). No statistically significant correlation was found among the presence of B-RAF V600E and gender, tumor node metastasis (TNM), multicentricity of the tumor, stage at diagnosis and outcome. In conclusion, the present study reports the prevalence of B-RAF V600E (38%) in the largest series of sporadic PTCs, including 260 cases from three different Italian referring centers. This prevalence is similar to that calculated by pooling together all data previously reported, 39.6% (759 out of 1914 cases), thus indicating that the prevalence of this genetic event lies around 3840%. Furthermore, B-RAF V600E was confirmed to be associated with the papillary growth pattern, but not with poorer differentiated PTC variants. A significant association of B-RAF mutation was also found with an older age at diagnosis, the mutation being very rare in childhood and adolescent PTCs. Finally, no correlation was found with a poorer prognosis and a worse outcome after a median follow-up of 72 months.
| Introduction |
|---|
|
|
|---|
B-RAF mutations have been described at high frequency in melanoma (70%) and, with a lower prevalence (1020%), also in colon and ovarian cancer, in lung and stomach cancer and in sarcomas (Davies et al. 2002). The prevalence of B-RAF mutated thyroid cancers varies between 23 and 62% among different series (reviewed in Fig. 1
), this variability being related to the heterogeneity of the histological types of PTC, to epidemiological factors or to the age group analysed. With the exception of the mutation K601E found in one follicular adenoma and four PTC follicular variants (Trovisco et al. 2004, 2005), the gene rearrangement AKAP9-BRAF described in one sporadic and three radiation-associated PTCs (Ciampi et al. 2005), the three nucleotide deletion (K601del) found in three metastatic lymph nodes and in a solid variant of PTC (Oler et al. 2005, Trovisco et al. 2005) and the three nucleotide insertion (V599Ins) found in a classic variant of PTC (Carta et al. 2006), the amino acid change B-RAFV600E is the only mutation consistently found in PTC. This mutation is of great importance because the V600 residue significantly contributes to the stabilization of the inactive conformation of the B-Raf kinase domain. The substitution of the valine with a glutamic acid (V600E) leads to the destabilization of the inactive conformation, promoting an active state and enhancing B-Raf kinase activity toward MEK (Wan et al. 2004, Wellbrock et al. 2004).
|
B-RAF mutations are present not only in papillary histotype, but also in anaplastic (Namba et al. 2003, Begum et al. 2004, Soares et al. 2004) and in poorly differentiated thyroid carcinomas, when a well-differentiated PTC component is present (Nikiforova et al. 2003). In the papillary histotype, B-RAF mutations are significantly associated with tumors with a papillary or mixed follicularpapillary growth pattern (Nikiforova et al. 2003, Fugazzola et al. 2004, Trovisco et al. 2004, 2005).
A correlation between older age at diagnosis and B-RAFV600E has been described (Nikiforova et al. 2003, Trovisco et al. 2005) and recently some authors have reported a low prevalence of B-RAFV600E in PTCs diagnosed in childhood (Kumagai et al. 2004, Lima et al. 2004, Penko et al. 2005, Powell et al. 2005, Rosenbaum et al. 2005). At present, no other unequivocal correlations between genotype and clinicopathologic features of PTC patients have been reported both in previous reports from the present authors (Fugazzola et al. 2004, Puxeddu et al. 2004) and in other more recent studies (Sedliarou et al. 2004, Kim et al. 2005, Liu et al. 2005, Trovisco et al. 2005). A few studies (Namba et al. 2003, Nikiforova et al. 2003, Xing 2005, Xing et al. 2005) have shown a correlation of B-RAFV600E with more advanced stage, nodal/distant metastases at diagnosis or tumor recurrence. Correlation with the male gender has been reported in a single study (Xu et al. 2003). These discrepancies might be due to the heterogeneity of the histological variants of PTCs, to epidemiological factors, to the age group analyzed or to the small number of cases studied.
The aim of the present co-operative study was to correlate B-RAFV600E with several clinical and pathological features in a large and homogeneous cohort of 260 Italian PTC patients in order to better define the prevalence of the mutation and the statistically significant correlations.
| Patients and Methods |
|---|
|
|
|---|
A series of 260 PTCs tissues were included in this study. In particular, the following histologic PTC variants were studied: classic (n = 176), follicular (n =51), others (including tall cell, oncocytic and solid variants, n =23) and poorly differentiated carcinomas, without well-differentiated components (n = 10). Samples were obtained consecutively at the time of surgery from the endocrine surgery units of the Universities of Milan, Perugia and Pisa, Italy. All tissues were snap frozen and archived at 80°C. In the three centers, histological diagnoses were carried out following the same criteria (LiVolsi 1990, LiVolsi et al. 2004, Rosai 2004) (Fig. 2
) and cancers were staged according to the last tumor node metastasis (TNM) staging system from American Joint Committee on Cancer 2002 and International Classification of Diseases for Oncology (ICD-O C73). In order to limit the variability of different case sets subjected to diverse histopathological interpretations, 230 out of 260 glass slides were histologically re-examined, in a blind manner, by experienced pathologists at the participating centers. All tumors were sporadic and excised from patients not exposed to external radiation or radioactive fall-out. The remission, persistence or recurrence of the disease was evaluated for each patient by radioiodine total body scan, thyroglobulin and anti-thyroglobulin auto-antibody measurement either when off L-thyroxine treatment or after recombinant human thyrotropin stimulus (thyrogen, thyrotropin
; Genzyme Corporation, Cambridge, MA, USA), neck ultrasound and fine needle aspiration cytology on suspicious masses. Because of the slow progression of most PTCs, for the statistical analysis, only patients (n = 81) with a follow-up longer than 24 months (median follow-up 72 months) were considered.
|
Data from 104 out of 260 cases (40%) included in the present study have been reported previously (n = 51 by Puxeddu et al. (2004) and n = 53 by Fugazzola et al. (2004)).
Methods
Two different techniques were used for B-RAF analysis on the tumoral specimens. About half of the samples were analyzed using tumor DNA while the others were studied using tumor RNA. All procedures for handling the tissues were approved by each hospital ethics committee. Informed consent was obtained from all screened subjects.
DNA and RNA extraction from tissues
To ensure a pure tumor tissue isolation in tumors <1.5 cm, microdissection was performed. In larger tumors, the core of the tumoral nodule was dissected macroscopically and analyzed after histological confirmation of malignancy. DNA was extracted from tumor tissues by means of commercial kits (Puregene; Gentra Systems, Minneapolis, MN, USA). RNA extraction was performed using Trizol reagent (Invitrogen Corp., Carlsbad, CA, USA), according to the manufacturers instructions.
PCR amplification and direct sequencing analysis
For B-RAF analysis, the DNA was PCR amplified using specific intronic primers (Xu et al. 2003) according to the following protocol: 35 cycles of denaturation (94°C for 1 min), annealing (60°C for 1 min) and extension (72°C for 2 min) on a TouchDown thermal cycler (Hybaid, Basingstoke, Middx, UK). After purification, PCR products were directly sequenced. An aliquot of 310 ng/100 bp purified DNA and 3.2 pmol of either the forward or reverse primer were used in standard cycle sequencing reactions with ABI PRISM big dye terminators and run on an ABI PRISM 310 genetic analyzer (PE Applied Biosystems, Foster City, CA, USA). The cycle-sequencing conditions consisted of 25 cycles of 96°C for 30 s, 50°C for 15 s and 60°C for 4 min. One sequence read from each direction across the entire coding region and including intronexon boundaries was obtained for each sample.
Reverse transcription and single-stranded conformational polymorphism (SSCP) analysis
Total RNA was submitted to reverse transcription with either AMV reverse transcriptase (Promega Corp., Madison, WI, USA) or Superscript reverse transcriptase II (Invitrogen Corp.) using a random hexamer mixture as primers. For each set of reactions a negative control tube containing double-distilled water and no nucleic acids was co-incubated.
All the cDNAs were submitted to a PCR using sets of primers designed to flank exon 15 of B-RAF (forward: CATTGCACGACAGACTGCAC; reverse: TCTGACTGAAAGCTGTATGG) according to the following protocol: 35 cycles of denaturation (95°C for 1 min), annealing (60°C for 1 min) and extension (72°C for 1 min) on an automated heat block (iCycler; BioRad, Hercules, CA, USA). Mutational analysis of PCR products was performed by SSCP screening. SSCP analysis was conducted using a method reported previously (Puxeddu et al. 2004). Briefly, 5 µl PCR product was mixed with 25 µl DNA gel-loading buffer (95% formamide, 20 mM NaOH, 20 mM EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol), denatured and loaded onto a 0.5 x mutation detection enhancement gel (MDE gel solution; Cambrex, Rockland, ME, USA) containing 10% glycerol. Gels were run in 0.6 x TrisborateEDTA buffer at 4 W overnight using a D-code universal mutation detection system (BioRad). Staining of the separated DNA bands on the gels was performed using the Gelstar nucleic acid gel stain (Cambrex). ARO and NPA human thyroid carcinoma cell lines were used as heterozygous and homozygous positive controls respectively, while WRO cells were used as negative control (Kimura et al. 2003). Direct forward and reverse sequencing of the PCR products showing a gel shift at SSCP analysis was conducted after purification with the Wizard SV gel and PCR clean-up system purification kit (Promega Corp.) on a 16 capillary DNA sequencer (ABI PRISM 3100 Genetic Analyzer; Applied Biosystems) at GeneLab (ENEA Casaccia, Rome, Italy) using the same primers as the PCR amplification. The results of the mutation screening for B-RAF of each sample were confirmed in at least two independent experiments.
Statistical analysis
Correlations between B-RAF mutation and various clinicopathologic parameters were analyzed in all 260 patients. The statistical analyses were obtained by means of t-test and
2/Fishers exact test. The difference between two values was considered significant when P < 0.05. All tests were performed using the Statistical Package for Social Sciences for Windows (SPSS Inc., Chicago, IL, USA).
| Results |
|---|
|
|
|---|
All mutations detected involved a T > A transversion at nucleotide 1799 (V600E) and were heterozygous. Overall, the B-RAFV600E mutation was found in 99 out of 260 PTCs (38%). It is worthy to note that about 40% of the negative samples (60 out of 161) were tested with the two methods (starting from RNA or from DNA) and the results were comparable. According to the histological type of tumor, the B-RAFV600E mutation was present in 48.3% of cases of classic PTC (85 out of 176), in 17.6% (nine out of 51) of follicular variants of PTC, in 21.7% (five out of 23) of other PTC variants and in none of the ten poorly dffrentiated tumors.
Correlation analysis between B-RAF mutation and clinical parameters
The correlation between B-RAFV600E and various clinicopathologic parameters were examined (Table 1
). The B-RAFV600E was significantly associated with the classic variant of PTC with respect to all the other variants (P = 0.0001). Moreover, B-RAFV600E was correlated with an older age at diagnosis (P = 0.01). It is worthy of note that only one out of ten patients
18 years of age harbored the B-RAF mutation. No statistically significant correlation of B-RAFV600E with gender, TNM, multicentricity of the tumor and stage of the disease at diagnosis was found. It should be noted that a trend towards a greater proportion of patients with B-RAFWT presenting at stage I was observed, but this was not statistically significant. As far as the outcome is concerned, this was analysed in the 81 patients with a follow-up longer than 24 months (median 72 months). Also for this parameter, no correlation with the presence/absence of B-RAF mutation was revealed.
|
| Discussion |
|---|
|
|
|---|
A significant correlation of B-RAFV600E was found with an older age at presentation (P = 0.01), confirming the data obtained in the series reported by Nikiforova et al. (2003).Moreover, in accordance with the reported low prevalence of this genetic event in children (Kumagai et al. 2004, Lima et al. 2004, Penko et al. 2005, Powell et al. 2005, Rosenbaum et al. 2005), nine out of ten PTCs in patients
18 years of age were B-RAFWT. On the contrary, RET activation has been demonstrated to be more frequent in PTCs originating during the first three decades of life (Bongarzone et al. 1996). On the basis of these observations, it is possible to postulate that childhood PTCs are genetically different from adulthood PTCs.
As far as other possible correlations between B-RAFV600E and the clinical features of PTC patients are concerned, no statistically significant differences in gender, stage, TNM, multicentricity or recurrence between B-RAF mutated and non-mutated cases were found. These results are in agreement with those reported in other series (Kim et al. 2005, Liu et al. 2005, Trovisco et al. 2005). On the contrary, previous data on the association of B-RAF with a worse stage and/or local or distant metastases or recurrence (Namba et al. 2003, Nikiforova et al. 2003, Xing 2005, Xing et al. 2005) are not confirmed in the present large series. However, it is worth noting that the multivariate analysis, which was indeed performed only in one of these studies (Xing et al. 2005), clearly demonstrated that when the histological subtypes of the PTCs were included, the significance of B-RAF mutation association with all the other high-risk pathological features of the tumor was lost. With regard to the association between B-RAFV600E and cancer recurrence described recently by Xing et al. (2005) and not found in the present series, a possible explanation could reside in the different median follow-up of the two cohorts (15 months in the paper by Xing et al. (2005) and 72 months in the present study).
The analysis of the prevalence of B-RAFV600E according to the geographic origin of cases showed a significantly higher prevalence of B-RAFV600E (P < 0.0001) in the cohort of patients coming from Umbria. Since this group was not significantly different from the others coming from north, center and south of Italy concerning sex, age, TNM, histology and including the variant of the PTC, we are tempted to speculate that a genetic shared background in this small area or the particularly high iodine deficiency of this region could be the explanation for this intriguing finding.
In conclusion, in this study we found that 38% of PTCs in this large series of Italian cases harbored a B-RAFV600E mutation. This prevalence is highly comparable with the worldwide mean prevalence. According to previous observations, this genetic event was found to be more frequently associated with the classic variant of PTC. Among all the other clinicopathologic features that we analyzed B-RAFV600E was found to be correlated only with an older age at diagnosis. In particular, no correlation was found with a poorer prognosis and a worst outcome after a median follow-up of 72 months.
| Funding |
|---|
The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Begum S, Rosenbaum E, Henrique R, Cohen Y, Sidransky D & Westra WH 2004 BRAF mutations in anaplastic thyroid carcinoma: implications for tumor origin, diagnosis and treatment. Modern Pathology 17 13591363.[CrossRef][Web of Science][Medline]
Bongarzone I, Fugazzola L, Vigneri P, Mariani L, Mondellini P, Pacini F, Basolo F, Pinchera A, Pilotti S & Pierotti MA 1996 Age-related activation of the tyrosine kinase receptor protooncogenes RET and NTRK1 in papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism 81 20062009.[Abstract]
Bongarzone I, Vigneri P, Mariani L, Collini P, Pilotti S & Pierotti MA 1998 RET/NTRK1 rearrangements in thyroid gland tumors of the papillary carcinoma family: correlation with clinicopathological features. Clinical Cancer Research 4 223228.[Abstract]
Carta C, Moretti S, Passeri L, Barbi F, Avenia N, Cavaliere A, Monacelli M, Macchiarlo A, Santeusanio F, Tartaglia M et al. 2006 Genotyping of an Italian papillary thyroid carcinoma cohort revealed high prevalence of BRAF mutations, absence of RAS mutations and allowed the detection of a new mutation of BRAF oncoprotein (BRAFV599Ins). Clinical Endocrinology 64 105109.[CrossRef][Medline]
Ciampi R, Knauf JA, Kerler R, Gandhi M, Zhu Z, Nikiforova MN, Rabes HM, Fagin JA & Nikiforov YE 2005 Oncogenic AKAP9-BRAF fusion is a novel mechanism of MAPK pathway activation in thyroid cancer. Journal of Clinical Investigation 115 94101.[CrossRef][Web of Science][Medline]
Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, Beller U, Westra WH, Ladenson PW & Sidransky D 2003 BRAF mutation in papillary thyroid carcinoma. Journal of the National Cancer Institute 95 625627.
Cohen Y, Rosenbaum E, Clark DP, Zeiger MA, Umbricht CB, Tufano RP, Sidransky D & Westra WH 2004 Mutational analysis of BRAF in fine needle aspiration biopsies of the thyroid: a potential application for the preoperative assessment of thyroid nodules. Clinical Cancer Research 10 27612765.
Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W et al. 2002 Mutations of the BRAF gene in human cancer. Nature 417 949954.[CrossRef][Medline]
Domingues R, Mendonca E, Sobrinho L & Bugalho MJ 2005 Searching for RET/PTC rearrangements and BRAF V599E mutation in thyroid aspirates might contribute to establish a preoperative diagnosis of papillary thyroid carcinoma. Cytopathology 16 2731.[CrossRef][Web of Science][Medline]
Elisei R, Romei C, Vorontsova T, Cosci B, Veremeychik V, Kuchinskaya E, Basolo F, Demidchik EP, Miccoli P, Pinchera A & Pacini F 2001 RET/PTC rearrangements in thyroid nodules: studies in irradiated and not irradiated, malignant and benign thyroid lesions in children and adults. Journal of Clinical Endocrinology and Metabolism 86 32113216.
Frattini M, Ferrario C, Bressan P, Balestra D, De Cecco L, Mondellini P, Bongarzone I, Collini P, Gariboldi M, Pilotti S et al. 2004 Alternative mutations of BRAF, RET and NTRK1 are associated with similar but distinct gene expression patterns in papillary thyroid cancer. Oncogene 23 74367440.[CrossRef][Web of Science][Medline]
Fugazzola L, Pilotti S, Pinchera A, Vorontsova TV, Mondellini P, Bongarzone I, Greco A, Astakhova L, Butti MG, Demidchik EP et al. 1996 Oncogenic rearrangements of the RET proto-oncogene in papillary thyroid carcinomas from children exposed to the Chernobyl nuclear accident. Cancer Research 55 56175620.
Fugazzola L, Mannavola D, Cirello V, Vannucchi G, Muzza M, Vicentini L & Beck-Peccoz P 2004 BRAF mutations in an Italian cohort of thyroid cancers. Clinical Endocrinology 61 239243.[CrossRef][Medline]
Fukushima T, Suzuki S, Mashiko M, Ohtake T, Endo Y, Takebayashi Y, Sekikawa K, Hagiwara K & Takenoshita S 2003 BRAF mutations in papillary carcinomas of the thyroid. Oncogene 22 64556457.[CrossRef][Web of Science][Medline]
Hayashida N, Namba H, Kumagai A, Hayashi T, Ohtsuru A, Ito M, Saenko VA, Maeda S, Kanematsu T & Yamashita S 2004 A rapid and simple detection method for the BRAF(T1796A) mutation in fine-needle aspirated thyroid carcinoma cells. Thyroid 14 910915.[CrossRef][Web of Science][Medline]
Kim KH, Suh KS, Kang DW & Kang DY 2005 Mutations of the BRAF gene in papillary thyroid carcinoma and in Hashimotos thyroiditis. Pathology International 55 540545.[CrossRef][Web of Science][Medline]
Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE & Fagin JA 2003 High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Research 63 14541457.
Kumagai A, Namba H, Saenko VA, Ashizawa K, Ohtsuru A, Ito M, Ishikawa N, Sugino K, Ito K, Jeremiah S et al. 2004 Low frequency of BRAFT1796A mutations in childhood thyroid carcinomas. Journal of Clinical Endocrinology and Metabolism 89 42804284.
Lima J, Trovisco V, Soares P, Maximo V, Magalhaes J, Salvatore G, Santoro M, Bogdanova T, Tronko M, Abrosimov A et al. 2004 BRAF mutations are not a major event in post-Chernobyl childhood thyroid carcinomas. Journal of Clinical Endocrinology and Metabolism 89 42674271.
Liu RT, Chen YJ, Chou FF, Wu WL, Tsai PC, Huang CC & Cheng JT 2005 No correlation between BRAF V600E mutation and clinicopathological features of papillary thyroid carcinomas in Taiwan. Clinical Endocrinology 63 461466.[CrossRef][Medline]
LiVolsi VA 1990 Papillary lesions of the thyroid. In Surgical Pathology of the Thyroid. Major Problems in Pathology, pp 136145.Ed. JL Bennington. Philadelphia: W.B. Saunders Company.
LiVolsi VA, Albores-Saavedra J, Asa SL, Baloch ZW, Sobrinho-Simoes M, Wenig B, DeLellis RA & Cady B 2004 Papillary carcinoma. In Pathology and Genetics of Tumours of Endocrine Organs World Health Organization Classification of Tumors, pp 5772. Eds RA DeLellis, RV Lloyd, PU Heitz & C Eng. Lyon: IARC Press.
Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T & Yamashita S 2003 Clinical implication of hot spot mutation, V599E, in papillary thyroid cancers. Journal of Clinical Endocrinology and Metabolism 88 43934397.
Nikiforova MN, Kimuea ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A et al. 2003 BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. Journal of Clinical Endocrinology and Metabolism 88 53995404.
Nikiforova MN, Ciampi R, Salvatore G, Santoro M, Gandhi M, Knauf JA, Thomas GA, Jeremiah S, Bogdanova TI, Tronko MD et al. 2004 Low prevalence of BRAF mutations in radiation-induced thyroid tumors in contrast to sporadic papillary carcinomas. Cancer Letters 209 16.[CrossRef][Web of Science][Medline]
Oler G, Ebina KN, Michaluart P Jr, Kimura ET & Cerutti J 2005 Investigation of BRAF mutation in a series of papillary thyroid carcinoma and matched-lymph node metastasis reveals a new mutation in metastasis. Clinical Endocrinology 62 509511.[CrossRef][Medline]
Penko K, Livezey J, Fenton C, Patel A, Nicholson D, Flora M, Oakley K, Tuttle RM & Francis G 2005 BRAF Mutations are uncommon in papillary thyroid cancer of young patients. Thyroid 15 320325.[CrossRef][Web of Science][Medline]
Perren A, Schmid S, Locher T, Saremaslani P, Bonvin C, Heitz PU & Komminoth P 2004 BRAF and endocrine tumors: mutations are frequent in papillary thyroid carcinomas, rare in endocrine tumors of the gastrointestinal tract and not detected in other endocrine tumors. Endocrine-Related Cancer 11 855860.
Porra V, Ferraro-Peyret C, Durand C, Selmi-Ruby S, Giroud H, Berger-Dutrieux N, Decaussin M, Peix JL, Bournaud C, Orgiazzi J et al. 2005 Silencing of the tumor suppressor gene SLC5A8 is associated with BRAF mutations in classical papillary thyroid carcinomas. Journal of Clinical Endocrinology & Metabolism 90 30283035.
Powell N, Jeremiah S, Morishita M, Dudley E, Bethel J, Bogdanova T, Tronko M & Thomas G 2005 Frequency of BRAF T1796A mutation in papillary thyroid carcinoma relates to age of patient at diagnosis and not to radiation exposure. Journal of Pathology 205 558564.[CrossRef][Web of Science][Medline]
Puxeddu E, Moretti S, Elisei R, Romei C, Pascucci R, Martinelli M, Marino C, Avenia N, Rossi ED, Fadda G et al. 2004 BRAF(V599E) mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. Journal of Clinical Endocrinology and Metabolism 89 24142420.
Rosai J 2004 Papillary carcinoma. In Rosai Ackermans Surgical Pathology, edn 9, pp 552555. Edinburgh: Mosby.
Rosenbaum E, Hosler G, Zahurak M, Cohen Y, Sidransky D & Westra WH 2005 Mutational activity of BRAF is not a major event in sporadic childhood papillary thyroid carcinoma. Modern Pathology 18 898902.[CrossRef][Web of Science][Medline]
Salvatore G, Giannini R, Faviana P, Caleo A, Migliaccio I, Fagin JA, Nikiforov YE, Troncone G, Palombini L, Basolo F et al. 2004 Analysis of BRAF point mutation and RET/PTC rearrangement refines the fine-needle aspiration diagnosis of papillary thyroid carcinoma. Journal of Clinical Endocrinology and Metabolism 89 51755180.
Santoro M, Carlomagno F, Hay ID, Herrmann MA, Grieco M, Melillo R, Pierotti MA, Bongarzone I, Della Porta G, Berger N et al. 1992 Ret oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype. Journal of Clinical Investigation 89 15171522.[Web of Science][Medline]
Sedliarou I, Saenko V, Lantsov D, Rogounovitch T, Namba H, Abrosimov A, Lushnikov E, Kumagai A, Nakashima M, Meirmanov S et al. 2004 The BRAFT1796A transversion is a prevalent mutational event in human thyroid microcarcinoma. International Journal of Oncology 25 17291735.[Web of Science][Medline]
Smyth P, Finn S, Cahill S, ORegan E, Flavin R, OLeary JJ & Sheils O 2005 ret/PTC and BRAF act as distinct, molecular, time-dependant triggers in a sporadic Irish cohort of papillary thyroid carcinoma. International Journal of Surgical Pathology 13 18.
Soares P, Trovisco V, Rocha AS, Lima J, Castro P, Preto A, Maximo V, Botelho T, Seruca R & Sobrinho-Simoes M 2003 BRAF mutations and RET/PTC rearrangements are alternative events in the etiopathogenesis of PTC. Oncogene 22 45784580.[CrossRef][Web of Science][Medline]
Soares P, Trovisco V, Rocha AS, Feijao T, Rebocho AP, Fonseca E, Vieira de Castro I, Cameselle-Teijeiro J, Cardoso-Oliveira M & Sobrinho-Simoes M 2004 BRAF mutations typical of papillary thyroid carcinoma are more frequently detected in undifferentiated than in insular and insular-like poorly differentiated carcinomas. Virchows Archives 444 572576.[CrossRef][Web of Science][Medline]
Trovisco V, Vieira de Castro I, Soares P, Maximo V, Silva P, Magalhaes J, Abrosimov A, Guiu XM & Sobrinho-Simoes M 2004 BRAF mutations are associated with some histological types of papillary thyroid carcinoma. Journal of Pathology 202 247251.[CrossRef][Web of Science][Medline]
Trovisco V, Soares P, Preto A, de Castro IV, Lima J, Castro P, Maximo V, Botelho T, Moreira S, Meireles AM et al. 2005 Type and prevalence of BRAF mutations are closely associated with papillary thyroid carcinoma histotype and patients age but not with tumour aggressiveness. Virchows Archives 446 589595.[CrossRef][Web of Science][Medline]
Vasilev EV, Rumiantsev PO, Saenko VA, Ilin AA, Poliakova EIu, Nemtsova MV, Zaletaev DV 2004 Molecular analysis of structural abnormalities in papillary thyroid carcinoma gene. Molecular Biology (Moscow) 38 642653.
Wan PTC, Garnett MJ, Roe SM, Lee S, Niculescu-Duvaz D, Good VM, Cancer Genome project, Jones CM, Marshall CJ, Springer CJ et al. 2004 Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116 855867.[CrossRef][Web of Science][Medline]
Wellbrock C, Karasarides M & Marais R 2004 The Raf proteins take centre stage. Nature Reviews Molecular Cell Biology 5 875885.[CrossRef][Web of Science][Medline]
Xing M, Cohen Y, Mambo E, Tallini G, Udelsman R, Ladenson PW & Sidransky D 2004a Early occurrence of RASSF1A hypermethylation and its mutual exclusion with BRAF mutation in thyroid tumorigenesis. Cancer Research 64 16641668.
Xing M, Vasko V, Tallini G, Larin A, Wu G, Udelsman R, Ringel MD, Ladenson PW & Sidransky D 2004b BRAF T1796A transversion mutation in various thyroid neoplasms. Journal of Clinical Endocrinology and Metabolism 89 13651368.
Xing M, Tufano RP, Tufaro AP, Basaria S, Ewertz M, Rosenbaum E, Byrne PJ, Wang J, Sidransky D & Ladenson PW 2004c Detection of BRAF mutation on fine needle aspiration biopsy specimens: a new diagnostic tool for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 89 28672872.
Xing M 2005 BRAF mutation in thyroid cancer. Endocrine-Related Cancer 12 245262.
Xing M, Westra W, Tufano RP, Cohen Y, Rosenbaum E, Thoden KJ, Carson KA, Vasko V, Larin A, Tallini G et al. 2005 BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. Journal of Clinical Endocrinology and Metabolism 90 63736379.
Xu X, Quiros RM, Gattuso P, Ain KB & Prinz RA 2003 High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Research 63 45614567.
This article has been cited by other articles:
![]() |
G. Vannucchi, M. Perrino, S. Rossi, C. Colombo, L. Vicentini, D. Dazzi, P. Beck-Peccoz, and L. Fugazzola Clinical and molecular features of differentiated thyroid cancer diagnosed during pregnancy Eur. J. Endocrinol., January 1, 2010; 162(1): 145 - 151. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Kwak, E.-K. Kim, W. Y. Chung, H. J. Moon, M. J. Kim, and J. R. Choi Association of BRAFV600E Mutation with Poor Clinical Prognostic Factors and US Features in Korean Patients with Papillary Thyroid Microcarcinoma Radiology, December 1, 2009; 253(3): 854 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Cirello, M. P. Recalcati, M. Muzza, S. Rossi, M. Perrino, L. Vicentini, P. Beck-Peccoz, P. Finelli, and L. Fugazzola Fetal Cell Microchimerism in Papillary Thyroid Cancer: A Possible Role in Tumor Damage and Tissue Repair Cancer Res., October 15, 2008; 68(20): 8482 - 8488. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Lin, S. D Finkelstein, B. Zhu, and J. F Silverman Molecular analysis of multifocal papillary thyroid carcinoma J. Mol. Endocrinol., October 1, 2008; 41(4): 195 - 203. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Elisei, C. Ugolini, D. Viola, C. Lupi, A. Biagini, R. Giannini, C. Romei, P. Miccoli, A. Pinchera, and F. Basolo BRAFV600E Mutation and Outcome of Patients with Papillary Thyroid Carcinoma: A 15-Year Median Follow-Up Study J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3943 - 3949. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Romei, R. Ciampi, P. Faviana, L. Agate, E. Molinaro, V. Bottici, F. Basolo, P. Miccoli, F. Pacini, A. Pinchera, et al. BRAFV600E mutation, but not RET/PTC rearrangements, is correlated with a lower expression of both thyroperoxidase and sodium iodide symporter genes in papillary thyroid cancer Endocr. Relat. Cancer, June 1, 2008; 15(2): 511 - 520. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sala, L. Mologni, S. Truffa, C. Gaetano, G. E. Bollag, and C. Gambacorti-Passerini BRAF Silencing by Short Hairpin RNA or Chemical Blockade by PLX4032 Leads to Different Responses in Melanoma and Thyroid Carcinoma Cells Mol. Cancer Res., May 1, 2008; 6(5): 751 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
F Frasca, C Nucera, G Pellegriti, P Gangemi, M Attard, M Stella, M Loda, V Vella, C Giordano, F Trimarchi, et al. BRAF(V600E) mutation and the biology of papillary thyroid cancer Endocr. Relat. Cancer, March 1, 2008; 15(1): 191 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M Cavaco, P. F Batista, C. Martins, A. Banito, F. do Rosario, E. Limbert, L. G Sobrinho, and V. Leite Familial non-medullary thyroid carcinoma (FNMTC): analysis of fPTC/PRN, NMTC1, MNG1 and TCO susceptibility loci and identification of somatic BRAF and RAS mutations Endocr. Relat. Cancer, March 1, 2008; 15(1): 207 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Xing BRAF Mutation in Papillary Thyroid Cancer: Pathogenic Role, Molecular Bases, and Clinical Implications Endocr. Rev., December 1, 2007; 28(7): 742 - 762. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lupi, R. Giannini, C. Ugolini, A. Proietti, P. Berti, M. Minuto, G. Materazzi, R. Elisei, M. Santoro, P. Miccoli, et al. Association of BRAF V600E Mutation with Poor Clinicopathological Outcomes in 500 Consecutive Cases of Papillary Thyroid Carcinoma J. Clin. Endocrinol. Metab., November 1, 2007; 92(11): 4085 - 4090. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Durante, E. Puxeddu, E. Ferretti, R. Morisi, S. Moretti, R. Bruno, F. Barbi, N. Avenia, A. Scipioni, A. Verrienti, et al. BRAF Mutations in Papillary Thyroid Carcinomas Inhibit Genes Involved in Iodine Metabolism J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2840 - 2843. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Mitsiades, J. Negri, C. McMullan, D. W. McMillin, E. Sozopoulos, G. Fanourakis, G. Voutsinas, S. Tseleni-Balafouta, V. Poulaki, D. Batt, et al. Targeting BRAFV600E in thyroid carcinoma: therapeutic implications Mol. Cancer Ther., March 1, 2007; 6(3): 1070 - 1078. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |