|
|
||||||||
University of Padua, Department of Histology, Microbiology and Medical Biotechnologies, Centre for Male Gamete Cryopreservation, Padua, Italy
1 University of Modena and Reggio Emilia, Department of Social, Cognitive and Quantitative Sciences, Modena, Italy
2 University of Padua, Department of Radiotherapy and Nuclear Medicine, Padua, Italy
3 University of Padua, Department of Oncological and Surgical Sciences, Padua, Italy
(Requests for offprints should be addressed to C Foresta; Email: carlo.foresta{at}unipd.it)
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Some risk factors for TC have been proposed, but the causes of TC remain still largely unknown. To date, other than cryptorchidism, few risk factors have been clearly demonstrated for TC (Chilvers et al. 1986, Giwercman 1992). About 710% of patients, who develop TC, report a history of undescended testis (Shottenfeld et al. 1980, Farrer et al. 1985, Whitaker 1988), with an increased relative risk of TC for excryptorchid men. Interestingly, this risk is not confined to the cryptorchid testis but also to the contralateral normally descended testis (Berthelsen et al. 1982, Pottern et al. 1985).
Recently, an association between TC and male infertility has been proposed (Berthelsen & Skakkebæk 1983, Giwercman et al. 1989, Prener et al. 1996, Arai et al. 1997, Herr et al. 1998, Jacobsen et al. 2000, Rørth et al. 2000) and common aetiological factors have been suggested. Increasing adverse factors in male reproductive health as reduced sperm quality, TC, undescended testis and hypospadias might be symptoms of one underlying entity named testicular dysgenesis syndrome (TDS) (Møller & Skakkebæk 1999, Skakkebæk et al. 2001, 2003, Aitken & Sawyer 2003, Bolsen et al. 2004). The aetiology of TDS is supposed to be related either to environmental factors, so-called endocrine disrupters (Weir et al. 2000, Huyge et al. 2004), and chemical toxicants (Toppari & Skakkebæk 1998, Guo et al. 2000) or to genetic factors (Rapley et al. 2000, Hemminki & Li 2004), including genetic susceptibility to endocrine disruption (Skakkebæk et al. 2003). TDS is supposed to arise during early foetal development when male reproductive tract formation, germ cell proliferation and Sertoli and Leydig cell differentiation occur (Yasuda et al. 1985, Sharpe & Skakkebæk 1993, Skakkebæk et al. 2001). According to this hypothesis, different degrees of TDS would be possible, the most severe cases including all the components, i.e. hypospadias, undescended testis, TC and spermatogenic impairment.
Anomalies in the androgen receptor (AR) gene could theoretically be a good candidate responsible for TDS. In fact, mutations in the AR gene cause different forms of androgen insensitivity leading to variable malformations, including micropenis, hypospadia, cryptorchidism and spermatogenic impairment (Brinkmann 2001, Sultan et al. 2001). Furthermore, this gene is essential for the development and maintenance of the male phenotype and spermatogenesis, and the androgen insensitivity syndrome (AIS) is a well recognized risk factor for TC (Savage & Lowe 1990). However, androgen insensitivity signs and mutations in the AR gene are not frequently reported in patients affected by TC.
The AR gene has two polymorphic sites in exon 1, characterized by different numbers of CAG and GGC repeats resulting in variable lengths of polyglutamine and polyglycine stretches in the N-terminal region of the AR protein. Longer CAG repeats result in a reduced AR transcriptional activity (Chamberlain et al. 1994, Choong et al. 1996), and there is evidence that an inverse correlation between CAG number and androgenicity exists. In fact, expansion of the CAG repeat tract to > 40 results in Kennedy syndrome, a rare motor neuron disorder which is also characterized by low masculinization, testicular atrophy, reduced sperm production and infertility (Brooks & Fischbeck 1995, Kazemi-Esfarjani et al. 1995). On the other hand, shorter AR polyglutamine tracts have been associated with increased prostate cancer risk (Giovannucci et al. 1997, Hakimi et al. 1997, Ingles et al. 1997, Stanford et al. 1997, Kantoff et al. 1998, Platz et al. 1998, Hsing et al. 2000, Ding et al. 2004), but this is still a controversial matter. Epidemiological studies suggest that CAG length may also play a role in TC. Afro- Americans have shorter CAG repeats than Caucasians (Irvine et al. 1994, Kittles et al. 2001, Lundin et al. 2003), and this trend parallels the low risk of TC in the former group (Shottenfeld et al. 1980). However, only two reports have analysed the possible association between CAG length and TC, with contrasting data (Rajpert-De Meyts et al. 2002, Giwercman et al. 2004). Furthermore, the functional consequences of variations in the GGC repeats are even less clear, and the joint distribution of CAG and GGC lengths in TC has never been analysed. This is particularly important because in a previous study (Ferlin et al. 2004a), we found that some combinations of CAG and GGC triplets were significantly associated with an increased risk of spermatogenic impairment.
To clarify these aspects, in this study, we analysed AR gene mutations and CAG and GGC repeats in men affected by different types of TC, and who consulted our Centre for semen cryopreservation after orchiectomy and before chemotherapy or radiotherapy.
| Materials and methods |
|---|
|
|
|---|
Patients and controls were prospectively recruited for this study with the approval of the Hospital Ethical Committee and informed consent was obtained from each subject after full explanation of the purpose and nature of all procedures used.
We evaluated 123 consecutive subjects (mean age 29.3 ± 7.1 years) orchiectomized for TC, who consulted our Centre for sperm cryobanking before initiating chemo- or radiotheraphy. All patients had a tumour in stage I at the time of our evaluation. A complete medical history and physical examination were undertaken. Two patients affected by seminoma had a familial history of TC. In the first the father and in the latter case a brother had a positive history of seminoma. Karyotype analysis and Y chromosome microdeletion analysis (Foresta et al. 1997, Ferlin et al. 2003, 2004b) were performed in all subjects to exclude other potential causes of testicular damage.
Among 300 fertile controls analysed for AR mutations we selected as controls 115 age-matched (28.8 ± 6.3) men who also had the determination of CAG and GGC repeats performed. These subjects were chosen on the basis of normozoospermia (World Health Organisation 1999) and absence of previous or familiar history of TC and served as controls. All patients and controls were of Caucasian origin and came from different Italian regions.
AR gene mutation analysis and determination of the CAG and GGC repeat number
AR gene mutation analysis and determination of the CAG and GGC repeat number were performed as previously described (Ferlin et al. 2004a). Genomic DNA was extracted from peripheral blood leukocytes using a DNA isolation kit (Roche). AR gene mutations were evaluated by PCR and direct sequencing, using a set of 11 oligonucleotide primers covering exons 18 (Lubahn et al. 1989). DNA samples isolated from testicular tumours to perform somatic AR mutation analyses were not available.
The number of CAG and GGC triplets was determined as follows: the AR exon 1 was amplified from genomic DNA in two different PCR reactions, giving overlapping amplicons. Both reactions are performed under the same conditions (standard conditions with 8% dimethylsulphoxide) and with the same cycle (94 °C for 1 min, 58° for 1 min, 72 °C for 1 min, repeated 37 times). The CAG repeat is contained in the amplicon produced with primers A0 GTGGTTGCTCCCGCAAGTTTCC and A5 GCTCCCACTTCCTCCAAGGACAATTA. It is sequenced with the primer A2 GCTGTGAAGGTTGCTGTTCCTC, using standard conditions for automated sequencing. The GGC repeat is amplified with primers A3n CAGCAAGAGACTAGCCCCAG and A10 CCAGAACACAGAGTGACTCTGCC, and it is sequenced with primer A8 GGACTGGGATAGGGCACTCTGCTCAACC. Primers A2, A5, A8 and A10 are from Lubahn et al. (1989), whereas we designed the new primers A0 and A3n (Ferlin et al. 2004a). Sequence analyses were performed by using the gap4 software of the Staden package (Staden 1996) available at the UK Human Genome Mapping Project webpage (http://hgmp.mrc.ac.uk/).
Statistical analysis
Differences in CAG and GGC mean repeat length among groups were tested by the Wilcoxons rank sum test. Differences among frequencies were calculated with a
2-test and Fishers exact test. Fishers exact test was used to analyse independence in the three two-way contingency tables. Adjusted residuals for the different haplotypes were computed to investigate in which way they depart from independence and differ from those of the control group. Relative risks and the corresponding 95% confidence intervals were calculated on the basis of the asymptotic normal distribution of these quantities. P<0.05 was considered statistically significant. A Bonferroni test was performed to correct for multiple comparisons. Computations were performed by using the open-source statistical software R.
| Results |
|---|
|
|
|---|
All 123 patients had a stage I TC and Table 1
reports their histotypes. Of the 123, totally 18 (14.6%) were excryptorchid subjects, and Table 2
reports the different histotypes and the side of TC and cryptorchidism in these patients. No other significant pathologies were found at history and physical examination.
|
|
Three out of 123 patients (2.4%) had mutations in the AR gene. One of them is an already reported mutation (www.androgendb.mcgill.ca) caused by a C to T transition in exon 1 leading to a proline to serine substitution in amino acid 390 (P390S). The same mutation was previously reported in two men affected by mild AIS with severe oligozoospermia. The other two are novel mutations. One is a trinucleotide deletion (CTG) in exon 1 leading to deletion of leucine in position 57 (Del L57), whereas the other is a G to A transition in exon 1 leading to an alanine to threonine substitution in amino acid 297 (A297T). All three patients had seminoma and did not have a history of cryptorchidism. None of 300 fertile subjects including our control group (115 subjects) had AR mutations.
Table 3
shows the mean number of CAG and GGC repeats in exon 1 of the AR gene in TC patients (22.3 ± 3.4, range 1131 and 17.2 ± 1.4, range 1020 respectively) and in proven fertile control men (21.6 ± 3.3, range 931 and 17.0 ± 1.7, range 821). These differences were not statistically significant. There was also no difference when the median value of CAG and GGC numbers were compared. The subgrouping of TC patients by a positive or negative previous history of cryptorchidism also showed no differences in terms of mean and median values of CAG and GGC repeat number with respect to controls (Table 3
). The distribution of CAG (Fig. 1a
) and GGC (Fig. 1b
) allele frequencies was not different between TC patients and control subjects. To explore the possibility that AR sensitivity could be determined by the total number of CAG and GGC repeats, we calculated the sum of triplets in each subject (CAG+GGC). This number was not different between controls and patients (data not shown). We also analysed whether TC men may have longer CAG repeats (Giwercman et al. 2004) by comparing the proportion of men with >23, >24, >25, >26 and >27 repeats. In this case, we also found no differences between patients and controls as well as between the different TC histotypes (data not shown). The same analysis was performed for GGC repeats (>18, >19 and >20) and no difference was found (data not shown). All these analyses to find a possible correlation of TC with either CAG and GGC repeats were also performed distinguishing GCTs and non-GCTs. This partition did not allow us to discern any statistically significant difference among the two groups, but these data cannot be conclusive because of the small number of the latter group.
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
In this study, we analysed AR gene mutations and CAG and GGC triplets in a large group of Italian patients affected by TC. We found a high prevalence of AR gene mutations (3 out of 123, 2.4%). One of these (P390S) was an already reported mutation (Hiort et al. 2000) found in two men affected by severe oligozoospermia. This mutation is located within a region of the AR that is important for transcriptional activity (exon 1). The importance of this amino acid residue is also highlighted by the finding of two cases of Pro390Leu affected by prostate cancer and one case of Pro390Asp affected by complete AIS (www.androgendb.mcgill.ca). The other two were novel mutations. The first was a trinucleotide deletion (CTG) in exon 1 leading to deletion of leucine in position 57 (Del L57). This amino acid is located just before the polyglutamine tract and belongs to a stretch of four leucines. The deletion of one of them may probably change the conformation of this domain, thus resulting in lower receptor activity. Supporting this hypothesis, a leucine to glutamine substitution in this codon has been associated with prostate cancer, a 30 nucleotide deletion involving this region has been associated with laryngeal cancer, and the insertion of an extra leucine at codon 58 was reported in two oligozoospermic men. The third mutation leads to an alanine to threonine substitution in amino acid 297 (A297T). Again, this mutation is located in the transactivation domain of the AR (exon 1). Even if mutations in this codon have never been reported and a direct causative effect cannot be drawn, the absence of the same mutation in more than 300 fertile control subjects evaluated for AR mutations, suggests a specific association with TC. All mutated patients had seminoma (3 out of 81, 3.7%) and did not have a history of cryptorchidism.
When evaluating CAG and GGC triplets we found that there is no difference with respect to control subjects when these variables are analysed separately both in GCTs and in non-GCTs. However, when joint distributions of CAG and GGC were analysed, we found significant differences. In fact, we observed that in TC subjects, differently from controls, the joint analysis of CAG and GGC showed a statistically significant dependence among these variable repeats. Furthermore, TC patients more frequently had the combination CAG=20/GGC=17 and when subjects with a previous history of cryptorchidism were not considered the prevalence of this combination was even more evident. The same results were unchanged also when analysing GCTs alone, which are usually considered to have a natural history very different from non-GCTs. On the contrary, considering only non-GCTs the analysis of the different CAG/GGC haplotypes did not show any significant difference, but we have to consider the poor number of these patients. However, we cannot completely exclude a chance association given the high number of statistical tests necessary in these cases.
Overall, the present study reports for the first time a high prevalence of AR gene mutations in young patients affected by TC, in particular seminoma. Furthermore, we did not find differences in CAG and GGC numbers between controls and TC patients in Italy. Our data confirm the absence of an association between CAG length and TC in Sweden (Rajpert De- Meyts et al. 2002), and we have no evidence of a relationship between this triplet both vs TC histotypes (as reported by Giwercman et al. 2004) and both vs GCTs or non-GCTs. Furthermore, we agree with the latter paper that suggested no relationship between GGC triplet length and TC. Another important finding is that CAG and GGC repeats are not independent in TC patients and the haplotype CAG=20/GGC=17 seems more frequently associated with TC in patients both with and without previous cryptorchidism. In fact, the relative risk results increased when considering all affected patients, and this risk is still present and seems even higher in patients without a predisposing factor for TC as cryptorchidism.
At this time, the association between CAG/GGC haplotypes and some clinical phenotypes such as infertility has been postulated (Ferlin et al. 2004a), but the mechanism by which they might cause TC are still unknown. We can suppose that different CAG/GGC combinations may modulate AR function, and that some haplotypes could determine an alteration in the trascriptional activity of the receptor. These findings cannot be conclusive, but nonetheless agree with another report on the association of CAG and GGC length and oesophageal cancer (Dietzsch et al. 2003).
In conclusion, our data indicate a significant prevalence of AR gene mutations in TC patients and thus it is possible to hypothesize a higher risk of TC in men with AR mutations. Furthermore, this study suggests that some particular CAG and GGC haplotypes might be more frequently associated with TC.
| Acknowledgements |
|---|
| References |
|---|
|
|
|---|
Agresti A & Finlay B 1997 Statistical Methods for the Social Sciences, edn 3. Upper Saddle River, NJ: Prentice Hall.
Aitken RJ & Sawyer D 2003 The human spermatozoonnot waving but drowning. Advances in Experimental Medicine and Biology 518 8598.[Web of Science][Medline]
Arai Y, Kawakita M, Okada Y & Yoshida O 1997 Sexuality and fertility in long-term survivors of testicular cancer. Journal of Clinical Oncology 15 14441448.[Abstract]
Berthelsen JG & Skakkebæk NE 1983 Gonadal function in men with testis cancer. Fertility and Sterility 39 6875.[Web of Science][Medline]
Berthelsen JG, Skakkebæk NE, von der Maase H, Sorensen BL & Mogensen P 1982 Screening for carcinoma in situ of the contralateral testis in patients with germinal testicular cancer. British Medical Journal 285 16831686.
Bolsen KA, Kaleva M, Main KM, Virtanen HE, Haavisto A-M, Schmidt IM, Chellakooty M, Damgaard IN, Mau C & Reunanen M 2004 Difference in prevalence of congenital cryptorchidism in infants between two Nordic countries. Lancet 363 12641269.[CrossRef][Web of Science][Medline]
Bosl GJ & Motzer RG 1997 Testicular germ-cell cancer. New England Journal of Medicine 337 242253.
Bosl GJ, Bajorin D, Sheinfeld J & Motzer R 1997 Cancer of the testis. In Cancer: Principles and Practice of Oncology, edn 5, pp 13971425. Eds VT De Vita, S Hellman & S Rosenberg. Philadelphia, PA: JB Lippincott.
Brinkmann AO 2001 Molecular basis of androgen insensitivity. Molecular and Cellular Endocrinology 179 105109.[CrossRef][Web of Science][Medline]
Brooks BP & Fischbeck KH 1995 Spinal and bulbar muscular atrophy: a trinucleotide-repeat expansion neurodegenerative disease. Trends in Neurosciences 18 459461.[CrossRef][Web of Science][Medline]
Chamberlain NL, Driver ED & Miesfeld RL 1994 The length and location of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect transactivation function. Nucleic Acids Research 22 31813186.
Chemes HE, Muzulin PM, Venara MC, del Caren Muhlman M, Martinez M & Gamboni M 2003 Early manifestations of testicular dysgenesis in children: pathological phenotypes, karyotype correlations and precursor stages of tumour development. Acta Pathologica, Microbiologica et Immunologica Scandinavica 111 1224.
Chilvers C, Dudley NE, Gough MH, Jackson MB & Pike MC 1986 Undescended testis: the effect of treatment on subsequent risk of subfertility and malignancy. Journal of Pediatric Surgery 21 691696.[Web of Science][Medline]
Choong CS, Kemppainen JA, Zhou ZX & Wilson EM 1996 Reduced androgen receptor gene expression with first exon CAG repeat expansion. Molecular Endocrinology 10 15271535.
Devesa SS, Blot WJ, Stone BJ, Miller BA, Tarone RE & Fraumeni JFJ 1995 Recent cancer trends in the United States. Journal of the National Cancer Institute 87 175182.
Dietsch E, Laubsher R & Parker MI 2003 Esophageal cancer risk in relation to GGC and CAG trinucleotide repeat lengths in the androgen receptor gene. International Journal of Cancer 107 3845.[CrossRef][Web of Science][Medline]
Ding D, Xu L, Menon M, Reddy GP & Barrack ER 2004 Effect of GGC (glycine) repeat length polymorphism in the human androgen receptor on androgen action. Prostate 62 133139.
Farrer JH, Walker AH & Rajfer J 1985 Management of the postpuberal cryptorchid testis: a statistical review. Journal of Urology 134 10711076.[Web of Science][Medline]
Ferlin A, Moro E, Rossi A, Dalla Piccola B & Foresta C 2003 The human Y chromosomes azoospermia factor b (AZFb) region: sequence, structure, and deletion analysis in infertile men. Journal of Medical Genetics 40 1824.
Ferlin A, Bartoloni L, Rizzo G, Roverato A, Garolla A & Foresta C 2004a Androgen receptor gene CAG and GGC repeat lengths in idiopathic male infertility. Molecular Human Reproduction 10 417421.
Ferlin A, Bettella A, Tessari A, Salata E, Dallapiccola B & Foresta C 2004b Analysis of the DAZ gene family in cryptorchidism and idiopathic male infertility. Fertility and Sterility 81 10131018.[CrossRef][Web of Science][Medline]
Foresta C, Ferlin A, Garolla A, Rossato M, Barbaux S & De Bortoli A 1997 Y-chromosome deletions in idiopathic severe testiculopathies. Journal of Clinical Endocrinology and Metabolism 82 10751080.
Giovannucci E, Stampfer MJ, Krithivas K, Brown M, Dahl D, Brufsky A, Talcott J, Hennekens CH & Kantoff PW 1997 The CAG repeat within the androgen receptor gene and its relationship to prostate cancer. PNAS 94 33203323.
Giwercman A 1992 Carcinoma-in-situ of the testis: screening and management. Scandinavian Journal of Urology and Nephrology. Supplementum 148 147.
Giwercman A, Brunn E, Frimodt-Møller C & Skakkebæk NE 1989 Prevalence of carcinoma in situ and other histopathological abnormalities in testes of men with a history of cryptorchidism. Journal of Urology 142 9981002.[Web of Science][Medline]
Giwercman A, Lundin KB, Eberhard J, Stahl O, Cwikiel M, Cavallin-Stahl E & Giwercman YL 2004 Linkage between androgen receptor gene CAG trinucleotide repeat length and testicular germ cell cancer histological type and clinical stage. European Journal of Cancer 40 21522158.[CrossRef][Web of Science][Medline]
Guo YL, Hsu PC, Hsu CC & Lambert GH 2000 Semen quality after prenatal exposure to polychlorinated biphenyls and dibenzofurans. Lancet 356 12401241.[CrossRef][Web of Science][Medline]
Hakimi JM, Shoenberg MP, Rondinelli RH, Piantadosi S & Barrack ER 1997 Androgen receptor variants with short glutamine or glycine repeats may identify unique subpopulations of men with prostate cancer. Clinical Cancer Research 3 15991608.[Abstract]
Hemminki K & Li X 2004 Familial risk in testicular cancer as a clue to heritable and environmental aetiology. British Journal of Cancer 90 17651770.[CrossRef][Web of Science][Medline]
Herr HW, Bar-Chama N, OSullivan M & Sogani PC 1998 Paternity in men with stage I tumours on surveillance. Journal of Clinical Oncology 16 733734.[Abstract]
Hiort O, Holterhus PM, Horter T, Schulze W, Kremke B, Bals-Pratsch M, Sinnecker GHG & Kreuse K 2000 Significance of mutations in the androgen receptor gene in males with idiopathic infertility. Journal of Clinical Endocrinology and Metabolism 85 28102815.
Hsing AW, Gao YT, Wu G, Wang X, Deng J, Chen YL, Sesterhenn IA, Mostofi FK, Benichou J & Chang C 2000 Polymorphic CAG and GGN repeat lengths in the androgen receptor gene and prostate cancer risk: a population-based case-control study in China. Cancer Research 60 51115116.
Huyge T, Matsuda T & Thonneau P 2003 Increasing incidence of testicular cancer worldwide: a review. Journal of Urology 170 511.[CrossRef][Web of Science][Medline]
Huyge E, Matsuda T, Daudin M, Chevreau C, Bachaud JM, Plante P, Bujan L & Thonneau P 2004 Fertility after testicular cancer treatments: results of a large multicenter study. Cancer 15 732737.
Ingles SA, Ross RK, Yu MC, Irvine RA, La Pera G, Haile RW & Coetzee GA 1997 Association of prostate cancer risk with genetic polymorphisms in vitamin D receptor and androgen receptor. Journal of the National Cancer Institute 89 166170.
Irvine RA, Yu MC, Ross RK & Coetzee GA 1994 The CAG and GGC microsatellites of the androgen receptor gene are in linkage disequilibrium in men with prostate cancer. Cancer Research 54 28612864.
Jacobsen R, Bostofte E, Engholm G, Hansen J, Skakkebæk NE & Møller H 2000 Fertility and offspring sex ratio of men who develop testicular cancer: a record linkage study. Human Reproduction 15 19581961.
Kantoff P, Giovannucci E & Brown M 1998 The androgen receptor CAG repeat polymorphism and its relationship to prostate cancer. Biochimica et Biophysica Acta 1378 C1C5.[Medline]
Kazemi-Esfarjani P, Trifiro MA & Pinsky L 1995 Evidence for a repressive function of the long polyglutamine tract in the human androgen receptor: possible pathogenetic relevance for the (CAG)n-expanded neuronopathies. Human Molecular Genetics 4 523527.
Kittles RA, Young D, Weinrich S, Hudson J, Argyropoulos G, Ukali F, Adams-Campbell L & Dunston GM 2001 Extent of linkage disequilibrium between the androgen receptor gene CAG and GGC repeats in human populations: implications for prostate cancer risk. Human Genetics 109 253261.[CrossRef][Web of Science][Medline]
Lubahn DB, Brown TR, Simental JA, Higgs HN, Migeon CJ, Wilson EM & French FS 1989 Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. PNAS 86 95349538.
Lundin KB, Giwercman A, Richthoff J, Abrahamsson PA & Giwercman YL 2003 No association between mutations in the human androgen receptor GGN repeat ad inter-sex conditions. Molecular Human Reproduction 9 375379.
Møller H 1993 Clues to the aetiology of testicular germ cell tumours from descriptive epidemiology. European Urology 23 813.[Medline]
Møller H & Skakkebæk NE 1999 Risk of testicular cancer in subfertile men: case-control study. British Medical Journal 318 559562.
Müller J 1987 Abnormal infantile germ cells and development of carcinoma-in situ in maldeveloped testes: a stereological and densitometric study. International Journal of Andrology 10 543567.[Web of Science][Medline]
Patel MI, Motzer RJ & Sheinfeld J 2003 Management of recurrence and follow-up strategies for patients with seminoma and selected high-risk groups. Urologic Clinics of North America 30 803817.[Medline]
Platz EA, Giovannucci E, Dahl DM, Krithivas K, Hennekens CH, Brown M, Stampfer MJ & Kantoff PW 1998 The androgen receptor gene GGN microsatellite and prostate cancer risk. Cancer Epidemiology, Biomarkers and Prevention 7 379384.
Pottern LM, Brown LM, Hoover RN, Javadpour N, OConnell KJ, Stutzman RE & Blattner WA 1985 Testicular cancer risk among young men: role of cryptorchidism and inguinal hernia. Journal of the National Cancer Institute 148 147.
Prener A & Østerlind A 1985 Cancer in Denmark. Copenhagen: Danish Cancer Registry.
Prener A, Engholm G & Jensen OM 1996 Genital anomalies and risk for testicular cancer in Danish men. Epidemiology 7 1419.[Web of Science][Medline]
Rajpert-De Meyts E & Skakkebæk NE 1993 The possible role of sex hormones in the development of testicular cancer. European Urology 23 5461.[Web of Science][Medline]
Rajpert-De Meyts E, Toppari J & Skakkebæk NE 2000 Testicular tumours with endocrine manifestations. In Endocrinology, edn 4, chapter 175. Eds LJ De Groot & JL Jameson. Philadelphia, PA: Saunders.
Rajpert-De Meyts E, Leffer H, Daugaard G, Andersen CB, Petersen PM, Hinrichsen J, Pedersen LG & Skakkebæk NE 2002 Analysis of the polymorphic CAG repeat length in the androgen receptor gene in patients with testicular germ cell cancer. International Journal of Cancer 102 201204.[CrossRef][Web of Science][Medline]
Rapley EA, Crockford GP, Teare D, Biggs P, Seal S, Barfoot R, Edwards S, Hamoudi R, Heimdal K & Fossa SD 2000 Localization of Xq27 of a susceptibility gene for testicular germ-cell tumours. Nature Genetics 24 197200.[CrossRef][Web of Science][Medline]
Rørth M, Rajpert-De Meyts E, Andersson L, Dickerman KP, Fossa SD, Grigor KM, Hendry WF, Herr HW, Looijenga LH & Oosterhuis JW 2000 Carcinoma in situ in the testis. Scandinavian Journal of Urology and Nephrology. Supplementum 205 166186.
Sakai N, Yamada T, Asao T, Baba M, Yoshida M & Murayama T 2000 Bilateral testicular tumours in androgen insensitivity syndrome. International Journal of Urology 7 390392.[CrossRef][Web of Science][Medline]
Savage MO & Lowe DG 1990 Gonadal neoplasia and abnormal sexual differentiation. Clinical Endocrinology 32 519533.[Medline]
Sharpe RM & Skakkebæk NE 1993 Are oestrogens involved in falling sperm counts and disorders of male reproductive tract? Lancet 341 13921395.[CrossRef][Web of Science][Medline]
Shottenfeld D, Warshauer ME, Sherlock S, Zauber AG, Leder M & Payne R 1980 The epidemiology of testicular cancer in young adults. American Journal of Epidemiology 112 232246.
Skakkebæk NE, Berthelsen JG, Giwercman A & Müller J 1987 Carcinoma-in situ of the testis: possible origin from gonocytes and precursor of all types of germ cell tumours except spermatocytoma. International Journal of Andrology 10 1928.[Web of Science][Medline]
Skakkebæk NE, Rajpert-De Meyts E & Main KM 2001 Testicular dysgenesis syndrome: an increasingly common developmental disorder with environmental aspects. Human Reproduction 16 972978.
Skakkebæk NE, Holm M, Hoei-Hansen C, Jørgensen N & Rajpert-De Meyts E 2003 Association between testicular dysgenesis syndrome (TDS) and testicular neoplasia: Evidence from 20 adult patients with signs of maldevelopment of the testis. Acta Pathologica, Microbiologica, et Immunologica Scandinavica 111 111.
Staden R 1996 The Staden sequence analysis package. Molecular Biotechnologies 5 233241.
Stanford JL, Just JJ, Gibbs M, Wicklund KG, Neal CL, Blumenstein BA & Ostrander EA 1997 Polymorphic repeat in the androgen receptor gene: molecular markers of prostate cancer risk. Cancer Research 57 11941198.
Sultan C, Paris F, Terouanne B, Balaguer P, Georget V, Poujol N, Jeandel C, Lumbroso S & Nicolas JC 2001 Disorders linked to insufficient androgen action in male children. Human Reproduction Update 7 314322.
Toppari J & Skakkebæk NE 1998 Sexual differentiation and environmental endocrine disrupters. Baillieres Clinical Endocrinology and Metabolism 12 143156.[CrossRef][Web of Science][Medline]
Toppari J, Haavisto A-M & Alanen M 2002 Changes in male reproductive health and effects of endocrine disruptors in Scandinavian countries. Cadernos de Saude Publica 18 413420.
Weir HK, Marrett LD, Kreiger N, Darlington GA & Sugar L 2000 Pre-natal and peri-natal exposures and risk of testicular germ cell cancer. International Journal of Cancer 87 438443.[CrossRef][Web of Science][Medline]
Whitaker RH 1988 Neoplasia in cryptorchid men. Seminars in Urology 6 107109.[Medline]
World Health Organization 1999 Laboratory Manual for the Examination of Human Semen and SpermCervical Mucus Interaction. Cambridge: Cambridge University Press.
Yasuda Y, Kihaja T & Taniura T 1985 Effect of ethinyl estradiol on the differentiation of mouse foetal testis. Teratology 32 113118.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
A. Ferlin, F. Ganz, M. Pengo, R. Selice, A. C. Frigo, and C. Foresta Association of testicular germ cell tumor with polymorphisms in estrogen receptor and steroid metabolism genes Endocr. Relat. Cancer, January 29, 2010; 17(1): 17 - 25. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Foresta, D. Zuccarello, A. Garolla, and A. Ferlin Role of Hormones, Genes, and Environment in Human Cryptorchidism Endocr. Rev., August 1, 2008; 29(5): 560 - 580. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ferlin, M. Pengo, R. Selice, L. Salmaso, A. Garolla, and C. Foresta Analysis of single nucleotide polymorphisms of FSH receptor gene suggests association with testicular cancer susceptibility Endocr. Relat. Cancer, June 1, 2008; 15(2): 429 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ferlin, E. Speltra, A. Garolla, R. Selice, D. Zuccarello, and C. Foresta Y chromosome haplogroups and susceptibility to testicular cancer Mol. Hum. Reprod., September 1, 2007; 13(9): 615 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
R P Amann and D N R Veeramachaneni Cryptorchidism in common eutherian mammals Reproduction, March 1, 2007; 133(3): 541 - 561. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rajpert-De Meyts Developmental model for the pathogenesis of testicular carcinoma in situ: genetic and environmental aspects Hum. Reprod. Update, May 1, 2006; 12(3): 303 - 323. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |